1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Free_Kalibri [48]
2 years ago
14

I WILL GIVE BRAINLY

Biology
1 answer:
spayn [35]2 years ago
3 0

Answer:

Potts

Explanation:

You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which of the following is not an acceptable way to thaw frozen food?
netineya [11]

Answer:

Perishable foods should never be thawed on the counter or in hot water and must not be left at room temperature for more than two hours. There are safe ways to thaw food: in the refrigerator, in cold water, and in the microwave.

Explanation:

3 0
3 years ago
Read 2 more answers
Science fusion grade 7 lesson 1 review
dem82 [27]

4) The simplest type of response is a direct one-to-one stimulus-response reaction. A change in the environment is the stimulus; the reaction of the organism to it is the response. In single-celled organisms, the response is the result of a property of the cell fluid called irritability.

5) During meiosis, the cells needed for sexual reproduction divide to produce new cells called gametes. Gametes contain half as many chromosomes as the other cells in the organism, and each gamete is genetically unique because the DNA of the parent cell is shuffled before the cell divides.

6)Producers can make their own food by capturing the sun's energy, but consumers and decomposes can't. Consumers need to eat other organisms to obtain energy. Decomposes are like the recycles of nature. They obtain energy for their own needs while returning simple molecules to the environment.

7)The birds are growing up into a larger bird.

8) Cells manage a wide range of functions in their tiny package growing, moving, housekeeping, and so on and most of those functions require energy. But how do cells get this energy in the first place? And how do they use it in the most efficient manner possible?

9)Aside from the fact that fish,and trees can be aged in similar ways (by counting annual growth rings), new research shows that all three also respond to climate change in similar ways.


10)No we will not be able to survive cause there is no food or water and it is only oxygen of course you will be able to breathe but not eat or drink.


HOPE THIS HELPS

7 0
3 years ago
What are the nitrogenous bases found in dna?
REY [17]
<span> Adenine, Guanine, Thymine, and Cytosine :)</span>
6 0
3 years ago
Explain how prokaryotic and eukaryotic cells are similar
STatiana [176]

Answer:

Like a prokaryotic cell, a eukaryotic cell has a plasma membrane, cytoplasm, and ribosomes, but a eukaryotic cell is typically larger than a prokaryotic cell, has a true nucleus (meaning its DNA is surrounded by a membrane), and has other membrane-bound organelles that allow for compartmentalization of functions.

Explanation:

4 0
3 years ago
Other questions:
  • One part of the cell theory states that cells come from other cells. Which statement below best explains that that this part of
    8·1 answer
  • Researchers performing a well-designed experiment should base their conclusions on
    6·1 answer
  • Darwin studied actual birds on the galapagos islands instead of using a simulation. What do you call this simulation?
    7·1 answer
  • Which process breaks down sugars to make ATP when oxygen is present?
    15·1 answer
  • Several members of the same family were diagnosed with he same kind of cancer when they were unusually young. Which one of the f
    14·2 answers
  • Whos got favebook and can do me a favor?
    8·1 answer
  • Which of the following situations would be an example of sensory adaption? A. A loud noise suddenly startles a women as she is a
    8·1 answer
  • In 3-5 sentences how are viruses,prokarya , and eukaryotic cells different (include the words:cell,living,size,disease,animal,an
    6·1 answer
  • Cell ______, performs it’s functions, goes thorough ______________ to check mutations in DNA.
    15·1 answer
  • What is an argument in favor of using embryonic stem cells over adult stem cells?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!