Which type of organic molecule is made up of simple sugars that form long chains?

Biology

1 answer:

LiRa [457]3 years ago

4 0

Answer:

Carbohydrates

Simple sugars are known as monosaccharides. Carbohydrates also include long chains of connected sugar molecules. These long chains often consist of hundreds or thousands of monosaccharides bonded together to form polysaccharides.

Explanation:

Carbohydrates

You might be interested in

Hey guys I'm having some trouble with a few living environment questions

Anika [276]

Explanation:

guessing

amino acid?

protein building blocks

peptide bonds hold them together

7 0

3 years ago

Eukaryotic gene regulation takes place through the use of RNA-

Mice21 [21]

Answer:

Hi! Your answers are;

-transcription factors

-TATA boxes

-homeotic genes

Explanation:

Hope this helped! :)

7 0

3 years ago

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

5 0

3 years ago

What rule states that chemical elements are made up of atoms?

Naddika [18.5K]

All types of matter are made up of atoms...

5 0

3 years ago

A briefly explain the genetic and evolutionary implications of lederberg and lederberg’s (1952 finding that mutations adapted to

balandron [24]

Lederbergs' experiment of the prevalence of mutations before selective culture was proved by replica plating. They spread bacteria on the plate and allowed them to grow. Next, they stamped the growth on the new plate which was already containing penicillin. The bacteria were able to grow on this plate, even when they never exposed to the antibiotic before. This proved that some of the bacteria were already mutated and were not as a result of exposure to selective culture conditions.

7 0

3 years ago