1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crank
3 years ago
13

Which of leonardo's experiments ended disastrously?

Biology
1 answer:
natima [27]3 years ago
5 0
The last supper ended disastrously because the type of paint quickly faded and chipped off. (I just searched this on the internet and found this there easy to find)
You might be interested in
During ____ the cell uses information from the messenger RNA to produce proteins
Bingel [31]
During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins
5 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
...........................
kupik [55]

Explanation:

what's your question?

4 0
3 years ago
Read 2 more answers
When a protein (peptide) hormone binds to receptors on the surface of a cell:
Licemer1 [7]

Answer:

the cell membrane becomes depolarized.

Explanation:

Na+ moves in, K+ moves out.

hope it helps!

7 0
3 years ago
Read 2 more answers
What is the equation used to measure liquid pressure?​
klasskru [66]

Set up the equation.

Since gravity and liquid densities are fixed (for the most part), the height of the liquid is the largest variable in the equation. The equation reads as Pfluid = ρgh, where ρ is the density of the liquid, g is the acceleration of gravity, and h is the height of the liquid (or depth of the fluid)

5 0
3 years ago
Other questions:
  • Wave energy is a type of ocean based renewable energy source that uses the power of the waves to generate electricity. Where is
    6·1 answer
  • What is conduction or the definition of conduction
    11·2 answers
  • Enzymes are made of protein and a non protein therefore they can not be denatured? True or false?
    13·1 answer
  • Membrane-bound organelles are not found in the cells of
    13·2 answers
  • Two different populations of birds live in the same area and eat the same type of food
    12·1 answer
  • Some people have low levels of calcium circulating in the blood, a condition known as hypocalcemia. While for many this disorder
    5·1 answer
  • In a typical data table, the first column of data represents the <br> variable.
    10·1 answer
  • Explain the concept of functional specialisation and describe two brain areas that exhibit functional specificity
    14·1 answer
  • Which type of objective lens are there in compound microscope. in one line​
    13·2 answers
  • What specialized structures does crayfish have that make it well suited to its environment​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!