3 years ago

This is data from a visible satellite image. What types of weather conditions are associated with the image?

2 answers:

6 0

Hurricanes (also known as typhoons or cyclones, depending on the location on Earth where they form) are often associated with extremely powerful winds and torrential rains. I am not sure about the pressure, but the only option here that mentions both strong winds and a lot of rain is A. low pressure, high winds, high precipitation, so I'd say that is the correct answer.

Gwar [14]3 years ago

4 0

Answer:

Explanation:

You might be interested in

Which characteristic allows the water in aquatic ecosystems to absorb large amounts of energy without a large rise in temperatur

Lera25 [3.4K]

The answer is specific heat ( APEX)

7 0

3 years ago

Read 2 more answers

CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

miss Akunina [59]

A because like what even is this??

4 0

3 years ago

Eco-friendly means of production

ASHA 777 [7]

Eco- friendly means earth friendly or not harmful to environment

3 0

3 years ago

A ___ is required to transfer genes from organism to another

sveticcg [70]

Answer:

DNA Carriers must be transferred or carried from one organism into another

6 0

3 years ago

Biology answers many questions, but it’s main focus is

iragen [17]

Answer:

The animals of the Earth and their environment the history of life on Earth how people and animals interact and live how living organisms interact and function Biology answers many questions, but its main focus is how living organisms interact and function.

Explanation:

8 0

3 years ago