plants cannot sustain themselves because they need dirt for fertilizer the sunlight to grow in water for hydration. they also need homeostasis for a heathy balance
The best answer is D.
Genetic information for synthesis of a protein is transmitted from DNA to the ribosomes, which are the site for protein synthesis. This is facilitated by messenger RNA or mRNA in short.
In the nucleus of the cell, information from DNA is copied (transcribed) onto mRNA which leaves the nucleus and enters the cytoplasm where it attaches to the ribosome. The information on the attached mRNA is decoded and read ( translated) by transfer RNA (tRNA) which then brings corresponding amino acids to the ribosome to be linked together to form the protein.
Answer:
change in temperature
change in color
noticeable odor after reaction has begun
formation of precipitate
formation of bubbles
Depend if you are more creative or more a solver(good in math).
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
