1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elanso [62]
2 years ago
14

3. Describe how increased carbon dioxide emissions can affect residents of coastal regions.

Biology
1 answer:
Deffense [45]2 years ago
3 0

Answer:

Coasts are sensitive to sea level rise, changes in the frequency and intensity of storms, increases in precipitation, and warmer ocean temperatures. In addition, rising atmospheric concentrations of carbon dioxide (CO2) are causing the oceans to absorb more of the gas and become more acidic.

You might be interested in
Which is not a function of proteins?
irga5000 [103]
Your answer is B antibody

4 0
3 years ago
What do the results of the agar blocks indicate about the relationship between cell size and diffusion rate
Natasha_Volkova [10]

Answer:

Knowledge of the relationship between the size (volume) of cells and their surface area helps explain the process of diffusion. Agar blocks and cells with the largest surface area to volume ratio (the smaller cubes) have the highest diffusion rates.

Explanation:

6 0
3 years ago
Read 2 more answers
A unique feature of muscle tissue is that it is capable of
kogti [31]

Answer:

Contraction.

Explanation:

Muscle tissues are defined as they are elastic and extensible in nature. In other words it's also defined as they are able to stretched and returned to its original size and shapes. A unique feature of muscle tissue is they are able of contractile in nature. With the help of this contraction they are able to sliding myosin and actin filaments which are present in muscles tissues.

Basically muscle tissues are three types:

1) Skeletal muscle: They are strong and rapid in contraction.

2) Cardiac muscle: They are strong in contraction.

3) Smooth muscle tissues: They are slow and weak in contraction.

4 0
3 years ago
Modern whales evolved from mammals that lived on land. Fossil evidence reveals that one characteristic that has changed over tim
lana [24]

Answer: Its A my friend, how it helps!.

Explanation: I just completed the Test.

6 0
2 years ago
Read 2 more answers
I need help. The class of macromolecule that would most likely be involved in contracting muscles would be ?
Juliette [100K]

Answer:

B

Explanation:

3 0
1 year ago
Read 2 more answers
Other questions:
  • A bacterium that is transformed: Select one:
    13·1 answer
  • How are dry climate regions identified?
    10·2 answers
  • The enzyme ________ unzips and unwinds the dna molecule.
    10·2 answers
  • Which statement is true about DNA ? a.Both of the original DNA strands act as templates during replication. b.It is a single-str
    9·1 answer
  • In a paramecium, the nucleus divides first and then the cytoplasm divides, forming two identical daughter cells. Which type of r
    13·2 answers
  • The equation below can be used to find h, the number of hours it will take Abbott and Costello to prepare Thanksgiving dinner.
    6·1 answer
  • A biology student sketched the following cell during a lab as he observed it in the last stage of mitosis. The cell lacked a cel
    11·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • HELP !!
    14·2 answers
  • When digested, proteins are broken down into _____. glycerol only fatty acids only monosaccharides amino acids both glycerol and
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!