1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zielflug [23.3K]
3 years ago
8

IS IT WEATHERING, EROSION, OR DEPOSITION?

Biology
1 answer:
Sholpan [36]3 years ago
4 0

Answer:

Weathering

Explanation:

The answer is weathering because, weathering is the breaking or wearing down of rocks, soil, minerals, and wood. The water wore down the rock, making it smooth, so it connects to the definition that i just gave you.

Hope it helped!

You might be interested in
What is the picture showing ?
Alika [10]

Answer:

a mixture of elements

Explanation:

hope that helped

6 0
3 years ago
?How do parallel fibers in the cerebellum control the duration of a response? ?By determining the number of Purkinje cells that
yKpoI14uk [10]
The appropriate response is the second one. Parallel fibers emerge from granule cells in the cerebellar cortex. Granule cells are little and exceptionally various. They are thought to make up the same number of as half of the neurons in the cerebrum. Granule cells have axons which ascend and afterward fan out into parallel filaments. These filaments meet the Purkinje cell dendrites.
7 0
4 years ago
Plz help me well mark brainliest if you are correct!
Paladinen [302]

Answer:

A

Explanation:

A meteor is a rock falling from the galaxy and usaully is burning because of the atmosphere.

5 0
3 years ago
Read 2 more answers
Why is circulatory system is important in meeting the needs of all cells throughout an animal's body
AfilCa [17]
It helps the cell by making sure everything gets circulated throughout the cell
5 0
3 years ago
Many biotic factors affect individuals in a population. An example of an organism being directly affected by a biotic factor is
labwork [276]
<span>Biotic factors can affect individuals by many factors in a population due to the common places that they might be accustomed to gathering, maybe a cathedral or restaurant or even the electoral voting booth. A choices that a population makes as a group affect more than the majority inhibiting those who oppose until that choice is represented again and the population can change their vote, the ways of natural catastrophe can only be changed by changing what can be seen: putting a plant in a window, rerouting a maple tree, medicating an entire population, and making the most out of living in a homeless shelter.</span>
6 0
3 years ago
Other questions:
  • If the gene for flower color is a certain plant is incompletely dominant red and white, what will result in a cross between red
    7·1 answer
  • Which are characteristics of all living things? check all that apply.
    12·1 answer
  • The immune system protects against foreign substances and even some cancers. Explain how the
    6·1 answer
  • The plant in the following photograph has several features that allow it to survive in hot, dry climates, , waxy leaves that kee
    12·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • You have discovered a cell type in humans that has an unknown function. The cells are found in the epithelium of the lungs. It a
    10·1 answer
  • You begin as one cell. Compare the DNA in your brain cell to the DNA of your heart cells. Explain. PLZZ HELP
    11·2 answers
  • An adult fruit fly has eight total chromosomes and reproduces sexually. Correctly identify the parts of the diagram to show how
    8·2 answers
  • v-FLIPs are viral proteins that were first identified as modulators of apoptosis; they contain two death effector domains, which
    9·1 answer
  • 8. PART B: Which synonym would best maintain the
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!