1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
diamong [38]
2 years ago
11

Which type of respiration is the most efficient in producing ATP?*

Biology
2 answers:
ZanzabumX [31]2 years ago
7 0

Answer:

Aerobic respiration

Explanation:

Georgia [21]2 years ago
3 0

Answer:

lol it might be a estimate good luck its not the real answer its a estimate to the answer

Explanation:

You might be interested in
How did Rachel Carson's book, Silent Spring, alter the way people thought about and treated the Earth? ​
shepuryov [24]

Answer:Rachel Carson Book's "Silent Spring" changed the way people thought and treated the Earth by showing the destructive impacts of pesticide use on animal life. Explanation: ... Silent Spring is considered the first worldwide warning against the harmful effects of pesticide use in agriculture.

Explanation:

6 0
2 years ago
Which of the following is a density-dependent factor that may limit population growth?
Damm [24]
Spread of disease is density dependent because it is more severe the greater the population density as the disease would spread more easily. If there is low population density it would spread slower.
4 0
3 years ago
Two students set up the following apparatus in a lab: a pipette was filled with a mixture of yeast and apple juice and inverted
UkoKoshka [18]

Answer:

The most appropriate answer would be carbon dioxide and cellular respiration.

Yeast is a single-celled eukaryotic organism which is capable of doing anaerobic (fermentation) as well as aerobic respiration.

It uses cellular respiration (whether aerobic or anaerobic) for the production of energy, that is, adenosine triphosphate (ATP).

Cellular respiration refers to the set of chemical reactions which are involved in breaking down sugar or glucose to produce ATP. The carbon dioxide is produced as a byproduct.

Thus, yeast breakdown the sugar present in apple juice to produce ATP and carbon dioxide.

This carbon dioxide is released in the form of bubbles.

4 0
3 years ago
Read 2 more answers
The ability to make antibody quickly after second exposure to an antigen is due to?
antoniya [11.8K]
Ask the question I brainy.com
6 0
2 years ago
Which of the following vectors holds the largest pieces of DNA?
wolverine [178]

Answer:

c. YACs

Explanation:

YACs, the Yeast artificial chromosomes are the high capacity vectors designed to carry the eukaryotic genes and carry the insert of 200-2000 kb.

YACs carry origin of replication from yeast, selectable markers and sequences derived from telomeres and centromere to maintain the stability of the insert during cell division.

The insert size for plasmids, bacteriophage, PACs, and cosmids is about 0.1-10 kb, 5-25 kb, 100-300 kb, 35-45 kb respectively.

3 0
3 years ago
Other questions:
  • Which of the follow conditions is associated with too much body fat. A.Bladder Cancer B.Hemochromatosis C.Gallbladder disease D.
    12·1 answer
  • PLEASE HELP !!! Describe how and where viruses reproduce and the function of RNA and DNA in this process
    12·1 answer
  • The symbol for barium and number of neutrons
    10·2 answers
  • What makes metals like copper conductive to electricity
    7·1 answer
  • What only takes place in the reproductive organs ??
    10·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following is a cost of mining aluminum from new bauxite
    15·2 answers
  • Need help, will give Brainliest to right answer.
    9·1 answer
  • Label this diagram with these 4 words
    10·1 answer
  • Which of the following statements apply to the variation in human skin color
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!