1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bumek [7]
3 years ago
9

Stratovolcanoes are also known as

Geography
2 answers:
aleksandrvk [35]3 years ago
7 0
It’s known as a composite volcano

Dude on top is right^^
exis [7]3 years ago
5 0
The answer probably will be b
You might be interested in
during the second major wave of immigration,from the late 1800s to early 1900s, immigrants to the united states came mostly from
Law Incorporation [45]
They came from <span>Scandinavia, Italy, Poland, and Russia. Hope that helps! :)</span>
5 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Which country is home to a major lake that is half fresh water and half salt water?.
ipn [44]

Answer:

Kazakhstan

Explanation: Kazakhstan's Lake Balkhash is the 15th-largest lake in the world and the third-largest in Asia.

7 0
2 years ago
The new madrid fault zone in missouri has had some surprisingly big earthquakes. a magneto-hydro-astronomer at a small universit
suter [353]
Correct answer is d
8 0
4 years ago
Explain how Brexit and the European migrant crisis can be considered symptoms of globalization. Your response should be a paragr
Mariulka [41]

Answer:

i will help you

Explanation:

6 0
3 years ago
Other questions:
  • How do people die in tsunami?
    5·2 answers
  • You buy a house on a small inland lake and your front lawn ends at the water's edge. A lawn care company representative suggests
    7·1 answer
  • The four planets closest to the Sun have similar compositions (rock/metal), and all have solid surfaces. They are therefore grou
    11·1 answer
  • Which statement does NOT explain why access to popular culture is unequal for some people?
    9·1 answer
  • After 1976 China began to change. The Communist leader are trying to - *
    9·1 answer
  • What types of jobs typically are found in ghetto, inner-city neighborhoods?
    6·1 answer
  • Why are penguin damb THICK!!!!!! <br> give me a reel answer no game's why are penguins thick
    15·2 answers
  • Which Country actively practice a Tradtioanly system
    15·1 answer
  • Which star will die the quickest?
    7·2 answers
  • What is an example of a calcium carbonate deposit in the lithosphere
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!