1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rewona [7]
3 years ago
7

. Phosphorylation by chemiosmosis occurs

Biology
1 answer:
sertanlavr [38]3 years ago
3 0

Answer:

Explanation:

The free energy of the sequence of reactions that make up the electron transport chain is used during chemosmosis to pump hydrogen ions through the membrane, producing an electrochemical gradient. ... Oxidative phosphorylation is called the processing of ATP using the chemiosmosis mechanism in mitochondria.

You might be interested in
Proposed the polynucleic model, stating that DNA and RNA were composed of nucleotides
Bond [772]
Phoebes Levine proposed the polynucleic model (around 1910!).
8 0
3 years ago
there are hunters in this ecosystem killing goats , jackals wnd wilcats for food. the lion population will increase over time cl
amm1812
The lion population will decrease because their prey is being hunted
3 0
3 years ago
Which of the following statements describes an example of natural selection?
nignag [31]
An aloe vera plant possessing a trait for extra thick leaves survives very long droughts in deserts, while and aloe vera plant that doesn't have thick leaves doesn't.
7 0
4 years ago
Read 2 more answers
Ribosomes offer strong support for the common ancestry of all living things. In particular, our textbook shows information that
Daniel [21]

Answer:Yeast and Bacterial ribosomes have the same number of rRNAs in them

4 0
3 years ago
What are some of the byproducts of photosynthesis? (Chose all that apply)
Lunna [17]
I think Oxygen is the best answer.
6 0
3 years ago
Read 2 more answers
Other questions:
  • A testable hypothesis could be formed from which question
    15·2 answers
  • Which of the following is an INVERTEBRATE?<br> A) Butterfly<br> B) Wasp<br> C) Crab<br> D) Frog
    11·2 answers
  • which of the following is true about imprinting? a. it is often used in the training of adult animals. b. it always involves the
    11·1 answer
  • Microalgae
    13·1 answer
  • Please Help!!! Study the following ocean currents map.
    10·2 answers
  • The primer for DNA synthesis is an RNA molecule formed by the enzyme ________________.
    12·1 answer
  • T / F Nitrogen is present in carbohydrates but not proteins.
    12·1 answer
  • A solution that contains equal numbers of hydrogen and hydroxyl ions would be called _____. Acidic, basic, alkaline ,or neutral
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Please help it’s urgent!!! For these two question
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!