1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
Increased carbon in the oceans has caused the pH levels of the water to decrease. What is the largest impact of this ocean acidi
vitfil [10]
The answer is A as corals are very delicate to their surroundings 
3 0
3 years ago
Read 2 more answers
In the Northern Hemisphere, climate scientists observe seasonal changes in carbon dioxide concentration with the highest levels
Veseljchak [2.6K]

Answer:

do it yourself

Explanation:

5 0
3 years ago
Chemicals called ________ are stored in neurons and released when the cell is stimulated by a signal.
Papessa [141]

Answer:

Neurotransmitters

Explanation:

Neurotransmitters are the chemicals present in the body used for the propagation of action potential. These neurotransmitters are also known as the body chemical messengers.

Neurotransmitters are stored in the neural cells. These chemicals are generally released when the cell is stimulated by the specific signal. The effect of neurotransmitter may be excitatory or inhibitory.

Thus, the answer is option (4).

7 0
3 years ago
What have you learned about radioactive dating? Check all that apply.
Ksivusya [100]

A, B, and D


I hope this helps!

3 0
3 years ago
How are the various types of plants and fungi different from each other? What characteristics do plants and
melomori [17]

Answer:

While both are eukaryotic and don't move, plants are autotrophic - making their own energy - and have cell walls made of cellulose, but fungi are heterotrophic - taking in food for energy - and have cell walls made of chitin.

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Help me asap please
    6·1 answer
  • Which of the following correctly describes one of the paths through which energy flows in this ecosystem? A. Puffins receive ene
    9·1 answer
  • 2 ways a tree is important to the water cycle?
    13·1 answer
  • In meiosis, what makes up a tetrad
    12·2 answers
  • Which of the following statements about the formation of polypeptides from amino acids is true?
    9·2 answers
  • Which of the following correctly describes the importance of the nitrogen cycle?
    7·1 answer
  • What process forms water vapor to turn into clouds?​
    13·1 answer
  • which era characterized by the extinction of reptiles and the appearance of mammals is considered significant in geological hist
    14·1 answer
  • What is the size of the giraffe population?
    7·1 answer
  • Type the correct answer in the box. Spell all words correctly.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!