1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
Listed in the Item Bank are some key terms and expressions associated with the categories seen in the Venn Diagram. To find out
belka [17]

Answer:

Asexual Reproduction: Mitosis, genetic sameness

Sexual Reproduction: Meiosis, produces gametes, genetic variation,

Both: Nuclear Division, DNA replicated

Not too sure about the DNA replication but i hope this helps !

3 0
3 years ago
Antigens are Multiple Choice something made by a white blood cell to destroy a pathogen. membrane receptors on B-lymphocytes. di
Zolol [24]

Answer:

Something that an antibody or T-lymphocyte binds to

Explanation:

As per the definition, antigens are the substances or molecules that are capable of inducing an immune response. When our immune system detects any unwanted substance or molecule in our body, the specific type of antibody is made against that antigenic substance and the antibody made against it binds to the antigen so that the other immune cells can recognize it and destroy it and protect us form its harmful effect. T-cell are also involved in recognizing antibodies and specific T-cell can bind to the antigen.

8 0
3 years ago
Echinoderms _____. _____ Select one: a. have an exoskeleton of hard calcareous plates b. often use tube feet to move around in t
atroni [7]

Answer:

B. often use tube feet to move around in their environment

Explanation:

Tube feet are tiny tubular projections of echinoderms on the underside (oral side). They are a member of the echinoderm water vascular system.

Tubular feet are used for feeding, breathing and shifting. They are arranged around the sides, in grooves. They work by hydraulic pressure. They are used to transfer food in the centre to the oral mouth, and may stick to surfaces. Tube feet allow certain animals to stick and travel slowly to the ocean floor. for example starfish uses tube feet for the above functions.

Hence, the correct option is B.

4 0
3 years ago
When tumor cell DNA is examined from people at different stages of the same cancer type, mutations that are common to all of the
Travka [436]

The correct answer s act late in the disease.

Disease:

  • When tumor DNA is studied from cancer patients at various stages, the mutation will be comparable in all of them. Tumor DNA is frequently identified in the blood stream.
  • Disease is any adverse variation from an organism's normal structural or functional condition that is typically accompanied by a set of symptoms and is distinct from physical injury in origin.
  • illnesses. An abnormal state of an organism that interferes with its normal bodily functioning, frequently causes pain and weakness, and is typically accompanied by symptoms and indicators.
  • Disorders produced by organisms, infectious diseases are those caused by microorganisms such bacteria, viruses, fungi, or parasites. Numerous species live inside of our bodies. They are generally advantageous or even secure. But in specific circumstances, some bacteria have the capacity to cause disease.

Learn more about disease  here brainly.com/question/19813896

#SPJ4

5 0
2 years ago
A cell contains....
const2013 [10]

Answer:

B

Explanation:

A is just false- there is no bacteria or other organisms inside cells.

C is incorrect because cells have lots of different things inside them

D is only referring to the cytoplasm in cells.

4 0
3 years ago
Other questions:
  • What is a 3point tutn?
    13·1 answer
  • Which is not an echinoderm? <br><br>A) sea star <br>B) sea urchin<br>C) sand dollar<br>D) spider
    10·2 answers
  • Compare physical feature of freshwater and marine cetaceans. Speculate how those physical differences might provide advantages t
    5·1 answer
  • An individual who is blood type AB negative has what antigens
    12·1 answer
  • What happens if there is not enough ATP available
    12·2 answers
  • While brain efficiency can vary from person to person, certain activities seem to correlate with less cognitive decline. Which i
    6·1 answer
  • What is biology and what are the characteristics of all living things
    5·1 answer
  • Which process involves glucose reacting with oxygen to produce energy, carbon dioxide, and water?
    15·1 answer
  • BRAINLIEST AND 25 POINT COME BEFORE ITS TO LATE
    15·2 answers
  • Vertebrates can be classified in.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!