1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
Monoglycerides diglycerides and triglycerides are distinguished from one another by the
larisa [96]
Answer: they are distinguished from one another <span>by the number of fatty acids attached to the glycerol backbone.
</span>
<span>A monoglyceride is a  molecule formed by a glycerol backbone and one fatty acid covalently bonded to it through ester linkages.
</span>A diglyceride is a  molecule formed by a glycerol backbone and two fatty acid chains covalently bonded to it through ester linkages.
A tryglyceride is a  molecule formed by a glycerol backbone and three fatty acid chains covalently bonded to it through ester linkages.
3 0
3 years ago
Will somone pleas answer this
Wittaler [7]

Answer:

Main idea

Explanation:

3 0
3 years ago
Read 2 more answers
What is the type of sponge that mimics a synthetic sponge?
jekas [21]
A sea sponge is what mimics a synthetic sponge
3 0
3 years ago
Red light has the longest ______ of any color of visible light. a. amplitude c. period b. wavelength d. rarefaction
Romashka-Z-Leto [24]
B. wavelength is the answer
8 0
3 years ago
Read 2 more answers
Give the 3 products that are formed in the light-dependent reactions.
horrorfan [7]
ATP
NADPH
O2
Are the products formed
8 0
2 years ago
Other questions:
  • If your mother is homozygous recessive and your father is heterozygous for the autosomal dominant huntington disease, what are y
    10·1 answer
  • As the adolescent period progresses, more responsibility is placed on the individual to be responsible and mature. Please select
    13·2 answers
  • 1. Experiments are designed so that the control group differs from the experimental group by one
    5·1 answer
  • A 79 year-old male resident of a long term care facility has contracted clostridium difficile and is experiencing consequent dia
    13·1 answer
  • Insects are responsible for the destruction of a significant percentage of potential food harvests every year. Please select the
    5·2 answers
  • Currently, there are no known risks in genetically modifying crop species. TRUE FALSE
    10·1 answer
  • Which set of characteristics below describes a carbohydrate?​
    12·1 answer
  • Autoclaving is the most effective among all moist heat-related antimicrobial methods. (True or False)
    9·1 answer
  • What is the first stimulated structure in a reflex arc?​
    11·1 answer
  • What atoms make up water molecules sunlight molecules and carbon dioxide molecules
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!