1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
Give reasons. Cells need energy​
Firdavs [7]

Answer:

#carry on learning

hope it's held

mark me as brainliest

All living cells need energy to function in order for the chemical reactions occurring in the cells to take place. In humans this energy is obtained by breaking down organic molecules such as carbohydrates, fats and proteins.

4 0
2 years ago
What type of microscope has low magnification but allows you to observe very large specimen is because the larger working distan
lilavasa [31]

Answer:

Stereo microscopes, also called low-power microscopes, dissection microscopes, or inspection microscopes, are designed for viewing "large" objects that are visible to the naked eye at low magnifications (under 50x). A stereo microscope provides an upright and unreversed, 3-dimensional image of the specimen.

Explanation:

3 0
3 years ago
Read 2 more answers
.
Effectus [21]

Answer:

location, internal

5 0
2 years ago
Read 2 more answers
Which of these statements describes how monomers combine and create macromolecules?
Bas_tet [7]

Answer: Amino acids combine to make proteins.

Explanation:

7 0
1 year ago
Bones protect internal organs and help the body move. true or false?
kogti [31]
True. This is because bones provide the structural support and act as levers- along with your muscles, you can move. They protect internal organs by creating a hard framework around them, in a way.
Hope that helped you.
6 0
3 years ago
Other questions:
  • Why is cellulose considered to be a complex carbohydrate? It is composed of a complex arrangement of glucose molecules. It is co
    6·2 answers
  • BRAINLIESTTT ASAP!
    11·2 answers
  • If a mother is type A and has a child who is type B what are the possible blood types of the father​
    14·1 answer
  • How can the hypothalamus receive signals from both the nervous and endocrine systems?​
    8·1 answer
  • What happens to an organism's metabolism when body temperature changes
    12·1 answer
  • What percentage of nitrogen does our atmosphere contain?
    14·1 answer
  • Refer to this portion of a dichotomous key for fish identification to answer the question.
    14·2 answers
  • why are wind,hydroelectric, and geothermal energy resources not suitable for providing energy worldwind? NEED HELP ASAP
    12·1 answer
  • Dr. taylor’s cva occurred in the left cerebral hemisphere, near her language center. if dr. taylor’s cva had occurred in the sam
    11·1 answer
  • A museum curator collects fossils from two different periods. He has 400 from one period and 204 from a later period. He plans t
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!