1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
How is the DNA in your skin cells related to the DNA in your heart, liver, and lung cells?
MakcuM [25]

Answer:

With few exceptions, all cells in a person’s body have the same DNA and genes. As cells divide and grow different genes are expressed, resulting in different cell types. As cells divide and grow different genes are expressed, resulting in different cell types.

Explanation:

7 0
3 years ago
What is the name of each animal... for example at no. 3, there is a cat. Also tell whether it is a herbivore, carnivore, omnivor
Sindrei [870]

Answer:

1. Grass, producer

2. Mouse, herbivore

3. Cat, Carnivore

4. Mushrooms, decomposer

Explanation:

5 0
4 years ago
Read 2 more answers
You observed many sand hill cranes on your walk. Two sand hill cranes flapped their wings and hopped up and down when you walked
Anarel [89]

Answer:

This question lacks options, the options are:

A) symbiosis

B) ecosystem

C) community

D) population

E) biosphere

The answer is D) Population

Explanation:

Living organisms in an ecosystem are usually found in numbers living together in a given area. This is termed POPULATION in ecology. A population refers to the group of living organisms that belongs to the same species living together in the same habitat and have the ability to interbreed i.e. mate and reproduce with one another.

This is the case in this question where many sandhill cranes (large flying birds) were observed in a particular area, which represented their habitat. Asides the group of sandhill cranes living together, they were also observed to be interbreeding. This was evident in the observation of two sandhill cranes hopping up and down around their bright orange baby. This shows that members of the population are capable of mating and reproducing fertile offsprings.

This observation completes what a POPULATION is all about, hence, a population was observed.

5 0
3 years ago
Imagine that you are managing a large wildlife preserve that was formerly a cattle ranch. You know from historical accounts that
zhuklara [117]
Being that they don’t have any natural predators by that 10th generation it should be back to normal capacity because of all the hunting. Sometimes humans do things out of convenience because they think that those animals are pests but,sheep aren’t predators and they are actually a very essential part of the animal kingdom in the farms and how they distribute food and kind of take care of each other, other animals and help farmers tremendously. and I mean they’re kind of amazing creatures and they provide a lot of resources for us that there’s it’s not necessary for us to hunt them. We won about 100 head of black Angus beef cattle and we only feed them organic however we won’t kill them unless maybe one has a bad leg or if there’s like an anomaly somewhere other than that he’s happy as most humane as possible and I appreciate your question and I hope it helped.
6 0
3 years ago
Which of the following equations is the chemical reaction for cellular respiration?1. 6CO2 + 6H2O → C6H12O6 +6O22. CaSiO3 +CO2 →
Natali [406]

Answer:

Option 3,

Explanation:

In the process of cellular respiration, the sugar is oxidised to convert  into carbon dioxide , water and energy molecule ATP (Adenosine Tri Phosphate)

If the above chemical reaction is represented mathematically it will be as follows -  

C_6 H_{12} O_6 + 6 O_2 --> 6 CO_2 + 6 H_2 O + ATP

The above reaction is a balanced chemical reaction representing cellular reaction

Thus, option 3 is correct

8 0
3 years ago
Other questions:
  • A hydrocarbon has molecular formula C3H8. Identify the class of hydrocarbons it belongs to.
    7·1 answer
  • Which one of the following is a vestigial structure?
    10·1 answer
  • What will happen to the sound waves when the sound source is in motion
    7·1 answer
  • What is the concentration of sbo at the potential when cd2 will begin to be deposited?
    9·1 answer
  • Secondary succession can only occur as a transition from primary succession. Please select the best answer from the choices prov
    12·2 answers
  • The sympathetic system causes
    6·1 answer
  • Digeorge symdrome is characterized by a craft palate immune deficiency and development issues. Which chromosmal changes causes i
    6·1 answer
  • The two major divisions of the nervous system are the __________
    12·1 answer
  • Which choice is an example of a symbiotic association of a protozoan with its mode of association? . A Plasmodium in the blood c
    10·2 answers
  • .
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!