1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
A trait is a specific characteristic that varies from one individual to another. true or false.
Zigmanuir [339]
As per <span>Mendel studied seven pea plant </span>traits<span>, each with two contrasting characters. He crossed plants with each of the seven contrasting characters and studied their offspring. Each original pair of plants is the P (parental) generation. 

True !</span>
6 0
4 years ago
IM TAKING A QUIZ HELPPP Cells maintain differentiation (look similar to surrounding cells) is benign or malignant
abruzzese [7]

Answer:

We call such tumors benign; an example is warts. ... keep benign tumor cells, like normal cells, localized to appropriate tissues. ... instead, they invade surrounding tissues, get into ... Thus the major characteristics that differentiate metastatic (or malignant) ...

Explanation:

8 0
3 years ago
When oil spilled from the Exxon Valdez oil tanker in 1989 into Alaska's pristine waters, animals and birds felt the immediate ef
lyudmila [28]

Answer:

Oil immediately interferes with physical properties of feathers, hair and respiration, making it impossible for many animals to function properly.

Explanation:

For example, birds such as seabirds and bald eagles have to dive or get in the water at least partially in order to catch the fish they eat. Oil makes it impossible for these birds to locate their prey and when they get in contact with oil it makes it impossible for them to fly and be insulated against the cold. Otters and seals also lose insulation against cold water when their hair gets covered with oil and die of hypothermia. Orcas suffer from skin and eye irritation when they get in contact with oil and it may cause problems if it gets swallowed.

5 0
3 years ago
All of the following are true about genetics except:
lora16 [44]

Answer:

A: Many genes can affect a trait

B: A single gene can influenced many traits

C:Traits can be influence many environments

D: Patterns of dominance are not influenced by genes

Explanation:

its C Traits can be influence many environments

6 0
4 years ago
Which of these is the deepest part of the ocean floor? (2 points)
zavuch27 [327]
Answer: Ocean Trench !
6 0
3 years ago
Other questions:
  • A student examines a cell under the microscope and determines that it is a eukaryote. All but one structure could help the stude
    15·2 answers
  • Can someone help me please
    13·1 answer
  • Central tolerance occurs in the generative lymphoid organs <br> a. True <br> b. False
    7·1 answer
  • How can pollution affect the level of oxygen in water? Why is this<br> important?
    5·1 answer
  • Which of the following levels of organization is the smallest?
    14·2 answers
  • The enzymes involved in the pyruvate dehydrogenase complex are
    15·1 answer
  • Explain how yeast makes dough rise
    14·1 answer
  • What enzyme deficiency in RBC leads to hemolytic anemia due to oxidative stress? ​
    5·1 answer
  • Brainliest. buh dis for ah test
    9·1 answer
  • What is the porosity of the sand sample?<br> A)<br> 99%<br> B)<br> 72%<br> C)<br> 34%<br> D)<br> 16%
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!