1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
What type of microscopy would you use to study the detailed internal structure of a mitochondria? A.Light microscopy B.Scanning
dolphi86 [110]

Answer:

C: Transmission Electron Microscopy

Explanation:

Transmission Electron Microscopy shows the complex internal membrane structure of mitochondria

6 0
3 years ago
What is deffusion and give me an example
LUCKY_DIMON [66]
Ex. Air freshener.
simple diffusion is the process of a substance (such as air freshener) moving from high concentration to low concentration with little to no energy.
5 0
3 years ago
The process of cellular differentiation is a direct result of what?
True [87]

The process of cellular differentiation is a direct result of a differiental

7 0
3 years ago
Read 2 more answers
Can be utilized for energy if sugars not available
liraira [26]
Fats and Proteins can be used as a supplement for energy if sugar is not available.

Hope I helped :) <span />
8 0
3 years ago
Read 2 more answers
An earthquake has a high magnitude but a low intensity. Which statement best explains this?(1 point)
Lera25 [3.4K]

Answer:

Magnitude and Intensity measure different characteristics of earthquakes. Magnitude measures the energy released at the source of the earthquake. Magnitude is determined from measurements on seismographs. Intensity measures the strength of shaking produced by the earthquake at a certain location.

Explanation:

i hope it helps

6 0
3 years ago
Other questions:
  • Random spacing patterns in plants such as the creosote bush are most often associated with ________.
    12·2 answers
  • Which two families of flowering plants provide protein for the majority of humans?
    8·1 answer
  • If a woman starts ovulating at 13 and stops at 50; a) how many ova are likely to be released from her ovaries? b) about how many
    8·1 answer
  • What are the types of organs in the urinary system
    15·1 answer
  • Ice in a glacier flows somewhat like liquid water. What is the main difference?
    5·1 answer
  • Como ha llevado la evolucion a que este insecto phyllium giganteumparezca una hoja segun la teoria de lamarck
    13·1 answer
  • One atmosphere is the same as?
    8·2 answers
  • Design a conceptual or theoretical to explain how the environment climate change has changed over time and to mitigate these cha
    13·1 answer
  • Help me please I need to pass to be able to play <br> Earth and space btw
    12·1 answer
  • Valentina is at the beach and decides to head out into the water for a swim. As she swims away from shore, she gets caught in a
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!