AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
1 answer:
I don see the question if there is one can you explain and ill edit my answer to best fit
You might be interested in
Except the c) sweat gland
The answer is C. Golgi Apparatus
Answer:
no idea
Explanation:
C is the answer to your problem
Glucose and oxygen are the input molecules
