1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
Consequences of human interaction with the natural environment
pochemuha

Answer:

Humans impact the physical environment in many ways: overpopulation, pollution, burning fossil fuels, and deforestation. Changes like these have triggered climate change, soil erosion, poor air quality, and undrinkable water.

Explanation:

So, What Happens if Pollution Continues to Increase? ... Breathing air pollution hampers the functioning of lungs among healthy people resulting in respiratory inflammation and heart problems. Living in a polluted area and breathing toxic air increases the risk of cancer. Air pollution weakens the immune system

5 0
2 years ago
if a characteristic is X-linked it A. occurs mostly in males. B. occurs mostly in females. C. is always fatal. D. isn't any diff
Mademuasel [1]
A. Occurs mostly in males. 

Hope this helps. [:
6 0
3 years ago
Which of the following statements is correct with respect to the photosynthetic pathway of grass or a cactus?
Gnesinka [82]
In a cactus, carbon is fixed only during the day. this is because cacti need sunlight to perform photosynthesis. Have a great day :)
5 0
3 years ago
What is the mean of the data set [3,2,2,12,6,5,14,4]?<br><br>A.2<br>B.4<br>C.6<br>D.7
zysi [14]

Answer:

6

Explanation:

To find the mean of a data set, add all the values in the set together, and then divide the result by the number of values in the set.

3 + 2 + 2 + 12 + 6 + 5 + 14 + 4 = 48

There are 8 values in the data set.

48/8 = 6

So the mean of the data set is 6.

8 0
3 years ago
What elements are found in the human body? Give 3 examples (don’t give them complicated)
Vedmedyk [2.9K]

Answer:

hydrogen, oxygen, carbon and nitrogen

I did 4 instead :')

Explanation:

6 0
3 years ago
Other questions:
  • What brain areas are associated with swallowing, and if damaged, can result in swallowing difficulty?
    13·1 answer
  • What trophic level is the snake in
    5·2 answers
  • Which type of cell can duplicate indefinitely?
    8·2 answers
  • Which statement(s) corresponds correctly to a mutation?
    8·1 answer
  • Alice has not experienced a menstrual cycle for more than three months. which condition applies to alice?
    8·1 answer
  • John's class has been studying blood type and donations. John is not sure what blood type he has. At dinner, John asked him mon
    14·2 answers
  • 1. What will happen to slice pieces of potato when exposed to air?
    15·1 answer
  • 5. Asteroids and comets are both objects that orbit the sun.
    6·1 answer
  • What is composed of masses of nerve cells, with fibers, running upward and downward;
    7·1 answer
  • TRUE/FALSE. if one parent has all blue eyes in the family and the other parent has brown eyes can the baby have green eyes
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!