1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
Inflammation of vein
Inessa [10]
The answer is Phlebitis
5 0
3 years ago
Read 2 more answers
When does crossing over occur in meiosis?
Arte-miy333 [17]
The Crossing Over only occurs in the meiosis on prophase I and metaphase I
3 0
3 years ago
Read 2 more answers
One difference between human cheek cells and onion cells is: 1. the presence of cytoplasm 2. the absence of a nucleus in the pla
AysviL [449]

Answer:

3. the absence of a cell wall in human cells

Explanation:

Animal cells do not have cell walls. Cell membranes separate the cytoplasm of the animal cells from the surroundings and maintain their interior. Plant cells have cellulosic cell walls. A cell wall surrounds the cell membrane of a plant cell. Cell walls serve to provide structural support and protect plant cells from pathogens. Cell walls also help keep excess water out of cells so they do not burst. Therefore, human cheek cells would not have cell walls while the onion cells would have cell walls made up of cellulose.

6 0
3 years ago
A hot air balloon has a volume of 15 L when it’s released from sea level, where the pressure is 100 kPa. What will be the hot ai
Lunna [17]

Answer:

65 L

Explanation:

It is assumed that the temperature is constant at both the sea level and the altitude.

<em>According to the gas law, at constant temperature, the pressure of a gas is inversely proportional to its volume.</em> Mathematically:

P1V1 = P2V2 where P1 = pressure at initial volume, V1 = volume at initial pressure, P2 = pressure at final volume, and V2 = volume at final pressure.

In the illustration, V1 = 15 L, P1 = 100 kPa, V2 =?, P2 = 23 kPa

V2 = P1V1/P2 =  100 x 15/23 = 65.22 L

<u>The volume of the hot air balloon at the altitude would be 65 L</u>

5 0
3 years ago
Which of the following is called the “central science” because of its connection to many other branches of science?
Lana71 [14]
The answer is A because I’m in advanced classsss!!!
8 0
3 years ago
Other questions:
  • Which is the duct that carries tears from the eye to the nasal cavity?
    14·1 answer
  • Where do electrons come from
    8·2 answers
  • What’s the definition of chemical energy
    14·1 answer
  • In bacteria, the antibiotic chloramphenicol prevents amino acids from bonding. The MOST likely reason that bacteria die from tre
    10·1 answer
  • What would happen to a living organism if it were exposed to chemical capable of breaking down phospholipid bilayers
    12·1 answer
  • Ravi ran 200 metres race in sports day. He feels that his heart was beating faster than usual. a) Why was his heart beating fast
    5·1 answer
  • Place the terms into the correct column that describes the reactions of photosynthesis.
    12·1 answer
  • Why is preventing pollution at its source the first strategy in minimizing environmental risk?
    5·2 answers
  • Que diferencia se encuentra entre una célula vegetal y una animal?​
    8·1 answer
  • A group of students want to investigate erosion occurring naturally on a riverbank. The students decide to take pictures of the
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!