1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
8. What can be concluded from the evidence that coughs and sneezes are natural
andreyandreev [35.5K]

Answer and explanation:

8. <u>What can be concluded from the evidence that coughs and sneezes are natural  reflexes and from the evidence that our immune system attacks allergens? </u>

Coughing and sneezing are natural defense mechanisms that consist of the sudden expulsion of air from the respiratory tract, with the intention of expelling any substance harmful to the body.

Allergies are the product of an exaggerated response of the body to the presence of environmental substances, such as dust, fungi and pollen, called allergens. This abnormal response is caused by an immune system previously sensitized to these substances.

Under normal conditions, the immune system is designed to defend an individual against potentially harmful elements. Coughs and sneezes are natural defense mechanisms, which are exaggerated in allergy sufferers.

9. <u>What two possible reasons for the increase in allergies are explained in the passage? </u>

<em>- "Some scientists think our immune systems don't have enough to do ..." "... when our immune system have fewer germs to fight, they can get confused". </em>

According to the excerpt, an immune system that has been inactive due to less contact with germs, looks for a way to attack any substance foreign to the body, which would be a mechanism that promotes the presence of the allergic response.

The confusion of the immune system would be given in some people by reacting in an unusual way to environmental stimuli or food, which do not affect the majority of people.

<em>- ... "weather is warmer for longer periods now, so plants bloom longer .. release pollen, which is a common allergen". </em>

Plant pollen is considered an aeroallergen capable of producing the response with sneezing or coughing in sensitive people.

Other evidence implies an increase in the amount of aeroallergens, as a consequence of the temperature change. A warm temperature for long periods of time promotes flowering in plants more frequently, and there is more pollen dispersed in the environment.

10. <u>What can be concluded about the increase of allergies in the future?</u>

In the text it can be clearly seen how, according to statistical data, the presence of allergies in more people has increased over time.

Many factors may induce an increase in the number of allergic patients in the future, such as the example provided by the passage of children less exposed to germs due to the use of increasingly available medications.

  • <em>In the past, there were fewer allergies because the immune system remained active to defend the body without the help of drugs.</em>
  • <em>Additionally, the increase in processed food products may be a factor that in the future increases the appearance of allergies in the population. </em>
  • <em>Again, the environmental factor plays a determining role. Over time, many climatic changes occur, which, combined with environmental pollution, may lead to increased allergies in the future.</em>

In the images below you will find the information of the article about allergies.

7 0
3 years ago
Using complete sentences, compare conditions in the Belgian Congo with conditions in the Congo Free State under King Leopold II.
Alex_Xolod [135]
<span>Employee of the Elder-Dempster shipping company based out of Antwerp. Responsible for basically starting the international human rights movement in the Congo Free State. Created the Congo Reform Association and was a constant thorn in the side of Leopold II. He formed his own newspaper 'The West African Mail' and wrote 'Red Rubber' to publicise the atrocities committed by King Leopold II and his officers in the Congo.</span>
6 0
3 years ago
Read 2 more answers
The allele for curly hair is incompletely dominant. If a mother is homozygous for curly hair and the father is homozygous for st
jekas [21]
The answer is 100percent
4 0
3 years ago
Read 2 more answers
Explain the process of formation of complex proteins ​
solmaris [256]

Answer:

Proteins in a protein complex are linked by non - covalent protein - protein interactions. The process of complex formation comprises of steps namely : An encounter complex is formed that either proceeds towards final complex or dissociates again.

Explanation:

Proteins in a protein complex are linked by non - covalent protein - protein interactions. The process of complex formation comprises of steps namely : ... An encounter complex is formed that either proceeds towards final complex or dissociates again.

7 0
3 years ago
The egg cell of a plant is located in the <br> 1. style<br> 2. ovary<br> 3. stigma
Arturiano [62]

Hey there!

The egg cell of a plant is located in the <em>Ovary</em>.

Hope this helps!

4 0
3 years ago
Other questions:
  • A 30-year-old gravida 1 para 0 experienced a miscarriage at 10 weeks' gestation. she is rh negative. in light of this informatio
    13·1 answer
  • Cat claim and defend certain
    6·2 answers
  • What is gametogenesis?
    5·1 answer
  • Which statement correctly compares and contrasts the three stages of cellular respiration that occur in the presence of oxygen?
    14·2 answers
  • Distinguish between anabolism and catabolism?
    5·2 answers
  • If people from Georgia have just experienced an extremely cold winter the last couple of months, what would the climate most lik
    7·1 answer
  • Plzzz help I dont understand this
    10·1 answer
  • HELP FAST PLEASE JUST ANSWER FONT EXPLAIN
    13·1 answer
  • What do you do when you lost 99% of your brain cells? -Lily
    5·2 answers
  • 4 1 Your friend, Luis, recently told you that bacteria started MAGICALLY growing on the inside of his shoes causing his feet to
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!