1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
What list is composed of substances widely used for many years without apparent ill effects?
balu736 [363]
The list that is composed of substances that are widely used for many years without apparent ill effects is the GRAS. GRAS is an abbreviation for generally recognized as safe; it is an American food and drug adminstration designation where chemical or substance added to food is considered safe by experts, and therefore, it is exempted from the usual federal food, drug, and cosmetic Act. 
3 0
3 years ago
Why is oxygen important for all body cells?
Masja [62]

Answer:

Our body cells require oxygen to release energy.

Explanation:

The oxygen that we take in during respiration is used to break down the food we eat to release energy from it. When we breathe in oxygen, it diffuses into blood from the lung, where it is transported by red blood cells to the entire body to be used to produce energy.

8 0
3 years ago
EXPERT HELP: EXPLAIN THE ANSWER
NeTakaya

Answer:

b

Explanation:

8 0
2 years ago
Read 2 more answers
A fossil was found and determined by radiometric dating to be 11,400 years old. what is the ratio of carbon-14 to carbon-12 in t
LuckyWell [14K]

The answer would be 25%

Carbon 14 is radioactive material with 5700 year of half-time which will change it into carbon-12, a more stable substance. If the age of the fossil is 11,400 years old, then the amount of half-time passed would be: 11,400 years/ (5,700years/ half-time)= 2 half-time.

Since it undergo 2 half-time, the percentage should be: 100% * (1/2)^2= 25%

3 0
3 years ago
How the rock cycle impact the lithosphere ? im in sceince not biology
weeeeeb [17]
Plate movement impacts the folding of this layer.
6 0
3 years ago
Other questions:
  • When the heartbeat and pulse beat don't match what exists in the animal
    6·1 answer
  • The sex of the child is determined by the male parent. Justify your statement.
    10·1 answer
  • 1, based on what you know about blood, why would having a sickle cell anemia crisis result in a reduced red blood cell count, an
    6·1 answer
  • Some sea anemones can produce large colonies by reproducing asexually, but they can also produce planktonic larvae by reproducin
    10·1 answer
  • List all the similarities and differences of a plant cell and an animal cell
    7·2 answers
  • A student design an experiment to demonstrate an effect of the interaction between the atmosphere and soil which of these best d
    5·1 answer
  • During the second half of glycolysis, what occurs?
    9·1 answer
  • A blood vessel has a uniform inside diameter of 50mm. Blood density is 1050kg/m3 and vin is 1m/s. Blood pressure at the inlet is
    6·1 answer
  • Bacteria cells can be used to produce insulin for the treatment of diabetes in humans. Which best explains how the bacteria cell
    7·1 answer
  • Below is a Punnett square that shows a model of human
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!