1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
What do the cell walls of plants and the extracellular matrix of animal cells have in common?
Tasya [4]

here you go

Explanation:

What do the cell walls of plants and the extracellular matrix of animal cells have in common? They have functional connections with the cytoskeleton inside the cell.

7 0
3 years ago
Axones negativas del medio ambiente
timurjin [86]

Answer:

  1. Utilizar desodorantes en aerosol
  2. Beber agua en botella de plástico
  3. Arrojar un chicle al suelo
  4. Asearnos sin cerrar el grifo
  5. Consumir alimentos con aceite de palma
  6. Dejar las colillas en la playa
  7. Soltar un globo de helio al aire.

Explanation

6 0
2 years ago
A science fiction movie shows a spaceship traveling past Pluto, Saturn, the Moon, and the Andromeda galaxy. Which of these celes
Harrizon [31]

Answer:

The answer is D the Andromeda galaxy

Explanation:

6 0
3 years ago
Has anyone done this yet ? I need help
Mariana [72]

Answer:

A cube's surface area formula is SA = 6s^2 (s is the length of one of the sides.)

A cube's volume formula is V=a^3

The answer should be 216 for both equations.

Explanation:

Hope this helps. :)

4 0
3 years ago
Does ejaculation fluid and pee come from the same hole female
Rashid [163]
No it does not the female has 2 separate holes in their privates.
5 0
3 years ago
Read 2 more answers
Other questions:
  • What statement is mostly a scientific law
    12·1 answer
  • What does a surface area/volume ratio of 6:1 mean for the cell’s ability to get the materials it needs that move across its surf
    12·1 answer
  • Here is a food chain in a meadow. Use this food chain to answer this question. Which is the producer in the meadow? A. field mou
    15·2 answers
  • Melting weakens the attractive forces among molecules of a
    14·2 answers
  • During inhalation, air moves from the larynx directly to the _____.
    15·1 answer
  • - Explain the relationship between group behavior, an organism's survival, and the change in a species over time.
    10·1 answer
  • A DESCOBERTA DA CÉLULA
    10·1 answer
  • How is it possible to find the
    8·1 answer
  • Whitch is the best definition of activation energy
    10·1 answer
  • Organisms that are able to make organic molecules from inorganic sources, such as carbon dioxide and water, are called.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!