1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viktor [21]
3 years ago
8

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Biology
1 answer:
nydimaria [60]3 years ago
8 0

I don see the question if there is one can you explain and ill edit my answer to best fit

You might be interested in
Blood type is determined by multiple alleles and can be used to determine the possible parents of an offspring. In this case, th
Tasya [4]

Answer:

think is b

Explanation:

sorry if im qrong

3 0
2 years ago
Read 2 more answers
Based on the timeline, about how many years ago could the oldest mammalian organism have lived?
diamong [38]
200 millons years.
Hope this helps!
8 0
3 years ago
Read 2 more answers
Compare between photosynthesis and chemosynthesis<br> Helppppp
xxMikexx [17]

Answer:

Photosynthesis and chemosynthesis are both processes by which organisms produce food; photosynthesis is powered by sunlight while chemosynthesis runs on chemical energy.

Explanation:

hope it helps

6 0
3 years ago
Which were the elements to form in the earliest stage of the universe?
Doss [256]

Explanation:

AswerB

hydrogen, helium and lithium

It took 380,000 years for the electrons to be trapped in orbits nuclei forming the first atoms. (which is option B)

6 0
3 years ago
In science class, Blaine’s teacher puts one glow stick in a cup of hot water and another glow stick in a cup of cold water. She
svetoff [14.1K]
The glow stick that was in the cup of hot water will be brighter once it is bent. The production of more light is evidence that the chemical reaction in the glow stick is happening faster. The reaction happens faster, because increasing the temperature increases the rate of a chemical reaction.
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following changes the solid Earth the most? A. the rock cycle B. atmospheric convection C. the nitrogen cycle D. oc
    15·1 answer
  • Science:
    8·1 answer
  • Do green houses cause Pollution?
    6·1 answer
  • You are given an unknown organism to identify. It is unicellular and heterotrophic. It is motile, using many short extensions of
    15·2 answers
  • What is the stimulus shown in the photographs?
    8·1 answer
  • What is a sub-atomic particle?
    11·1 answer
  • In this Landsat image of a rain forest, healthy vegetation appears red and deforested areas appear light blue. What explains the
    5·1 answer
  • WILL GIVE BRAINIEST IF THEY GIVE A CORRECT ANSWER!!! 50 POINTS!!!!<br> what eats sunbeam snakes?
    9·2 answers
  • should a business owner be more interested in making money or doing what they are passionate about?why?​
    13·1 answer
  • How many amino acids must be obtained in the diet because they cannot be made by the body? A. 2 B.5 C.10 D.20
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!