1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katyanochek1 [597]
2 years ago
7

To a large extent, a protein's function is dependent upon its shape. What determines a protein's shape?

Biology
1 answer:
zheka24 [161]2 years ago
8 0

Answer:

The sequence of amino acids

Explanation:

You might be interested in
2. Describe the problem that McClintock suggested Harriet Creighton solve.
harina [27]

Answer:

'Cross experiments done by Morgan, illustrating the X-inheritance link of a mutation Thomas Hunt Morgan moved intensely in a program of breeding and crossing miles of fruit flies at New York University in a room that was renamed the Fourth of the Flies. He tried to mutate the flies with various means (X-rays, centrifuges, etc.) .The fruit fly which has 4 pairs of chromosomes. One of those pairs was identified as containing X and Y sex chromosomes. He applied Mendelian principles in flies. Morgan's inheritance study demonstrated inheritance linked to sex, and is one of the first evidences that confirm the chromosomal theory of cross-based inheritance. In 1909, Morgan detected a fruit fly (Drosophila melanogaster) with a strange mutation which he called "white eyes", due to the coloration of his eyes (contrary to normal, which is red). Analyzing this fly under the microscope Morgan discovered that it was a male, and could use it as a stallion so that he could observe how the new characteristic of white eyes would pass from generation to generation.All the offspring of this cross will have red eyes, which He made Morgan suspect that something strange had happened, since the color of the father's eyes could not have disappeared. He decided to take a couple of "daughters flies" and cross them together, just to see what happened. Morgan's surprise was very great, observing that among the "granddaughters" flies only males had white eyes. The problem then was to explain what had happened during the hereditary transmission for the color of the white eyes only the males possessed. .

7 0
3 years ago
first, drag the labels of group 1 to their respective targets to identify the types of sugars and the type of reaction shown.
Tasya [4]

drag the labels of group 1 to their respective targets to identify the types of sugars and the type of reaction shown .Disaccharide is created when a monosaccharide undergoes a dehydration event (loses water).

nomenclature and structures

The word "carbohydrate" refers to the majority of simple carbohydrates, which have the general elemental composition Cx(H2O)y. It is derived from the German "kohlenhydrate" and the related French "hydrate de carbone." According to the following imbalanced equation, their composition is related to the fact that they are created by photosynthesis from carbon dioxide and water:

Sugar + O2 + CO2 + H2O

The vast majority of naturally occurring carbohydrates present in living things, however, do not have the straightforward empirical formula Cx(H2O)y. Instead, the majority of naturally occurring carbohydrates are composed of oligomers (oligosaccharides or polymers (polysaccharides [Chapter 4]) by combining sugars with the other components of other molecules monosaccharide.

Learn more about monosaccharide here:

brainly.com/question/13416862

#SPJ4

6 0
1 year ago
Page 360 9.1. what shapes infancy? recreational drug use during pregnancy is very dangerous. which recreational drugs have been
algol13
<span>Based on a study of recreational drugs that have been linked with a higher incidence of sudden infant death syndrome was the use of Marijuana and other recreational drugs like cocaine, crack, crystal, amphetamine, methamphetamine, and speed but cocaine was the most commonly used drug. The basis of the infant sudden death was that both maternal and paternal were using at the time of conception and during in the latter stage of pregnancy. Tobacco smoking of the mother during pregnancy can also affect the life of the baby. There is statistics base on the study on how many percents it will affect the condition of the infant.</span>
8 0
3 years ago
Is the correlation between morbid obesity and cardiovascular disease strong?
sdas [7]
The answer is, "True". 
6 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • A change occurs in an environment that lasts for several thousand years and causes changes to the genetic makeup of several spec
    11·2 answers
  • what's the process in body cells that directly requires oxygen and identify the structure in red blood that transports oxygen to
    12·1 answer
  • Where in the cell is the tag incorporated into the protein?
    15·1 answer
  • What is the world’s MOST abundant nonrenewable fossil fuel?
    7·1 answer
  • An experiment wants to see if temperature will change the reaction rate for a chemical reaction. The same size and brand antacid
    8·2 answers
  • What animal can cause terrible things to the ecosystem?
    15·2 answers
  • What trend do you notice about proteins and fats in the graph?
    5·1 answer
  • The non essential part of a flower are the​
    15·1 answer
  • Why does Matt call his dog?
    10·1 answer
  • Give a reason why Neurotransmitters are broken down by an enzyme just after passing an impulse from one neuron to the other????
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!