1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kakasveta [241]
3 years ago
6

An intracellular signaling molecule produced by the binding of a ligand to a membrane-bound receptor is called a __________.

Biology
2 answers:
sammy [17]3 years ago
8 0

Answer:

The intracellular molecule produced by the receptor ligand complex is called Second messenger.

Explanation:

Receptors are membrane bound proteins which bind to the ligands which are also called first messengers and cause cellular changes. These intracellular changes are mediated by second messengers such as proliferation, differentiation, migration, apoptosis, transcription, contractions etc. They are specific for specific first messengers such as homones and growth factors. They relay the signals between the ligands to their target molecules in the cytosol or nucleus. Most common second messengers are cAMP, cGMP, DAG, IP3.

Signal amplification by second messenger can be explained by the example of IP3 which cayses the release of Calcium ions from the intracellular stores and cause contractions.

kirza4 [7]3 years ago
7 0

Answer:

An intracellular signaling molecule produced by the binding of a ligand to a membrane-bound receptor is called a <u>second messenger </u>.

Explanation:

The ligands bind to the receptors and produce response by different signalling pathways resulting in the activation of the effectors.

As the ligand bind to the membrane bound receptor , intracellular signalling molecule is produced called a second messenger that relay the signals recieved at the receptor site to the target molecules triggering the physiological changes at the cellular levels.

Most common second messengers include :

1) cyclic GMP

2) cAMP (cyclic AMP )

3) DAG (Diacyl glycerol )

4) ROS (Reactive oxygen species )

5) Ca (Calcium)

You might be interested in
A massive bluegill fish kill was observed in a lake near a power plant during the winter months. It was determined that the plan
Savatey [412]

Answer:

Option B

Explanation:

Option D is incorrect, as increased photosynthesis would increase oxygen supply present, not carbon dioxide supply.

Option C is incorrect, as increased decomposition would increase carbon dioxide released and oxygen present is reduced, not increased.

Option A is unlikely as if this were the case, increased oxygen levels would enable bluegill fish to survive as well.

8 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
3 years ago
What are 3 main types of connective types of tissue?
babymother [125]

Answer:

The major types of connective tissue are connective tissue proper, supportive tissue, and fluid tissue. Loose connective tissue proper includes adipose tissue, areolar tissue, and reticular tissue.

Explanation:

7 0
3 years ago
What is the goal of the European Union
galben [10]
Human rights and equality. One of the EU's<span> main </span>goals<span> is to promote human rights both internally and around the world. Human dignity, freedom, democracy, equality, the rule of law and respect for human rights: these are the core values of the </span>EU<span>.
- google</span>
4 0
3 years ago
How Long do cats live
Lena [83]

Answer:

2 to 16 yrs

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Primates reproductive strategies (compared to other mammals)
    6·2 answers
  • Inherited traits are passed down from our parents to us their offspring, by the information that is coded in our parents'
    13·1 answer
  • What device is used to measure the rate at which food energy is converted to another form?
    15·1 answer
  • What element is found in proteins but not in carbohydrates and lipids?
    11·1 answer
  • Which graph represents selection that may lead to reduced variation in a population?
    5·1 answer
  • How can you indentify the difference between a chemical and physical change and what are signs that a chemical change has occurr
    14·2 answers
  • Which of the following is a form of asexual reproduction
    7·2 answers
  • PLEASE HELP, ILL GIVE YOU A BRAINLY OR WHATEVER ITS CALLED!!! Why would two parents with dominant traits be able to pass down re
    14·1 answer
  • Describe how compartmentalization allows a proton gradient to be achieved.
    6·1 answer
  • Why does it matter that cold waters rise to the surface with many nutrients in a kelp forest?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!