1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shalnov [3]
3 years ago
15

CAN someone please help asap

Biology
1 answer:
kondor19780726 [428]3 years ago
8 0

Answer:

Explanation:

Xylem

You might be interested in
According to the principle of faunal succession, what must be true of the fossils on a layer below?
sesenic [268]
The answer to this is older, but it's not a proven fact even though schools teach it as if it were. It is still just a theory if you think about it with how much the earth moves, areas of rock could be complete upside down and no one would know, it would be like history in reverse.
8 0
4 years ago
Read 2 more answers
PLEASE HELP ME PLEASE
svlad2 [7]

Answer:

sun to plants, plants to animals, animals to waste I believe

6 0
3 years ago
Question 9 Lipids and proteins can be formed from carbohydrates. Which elements do these molecules have in common that help form
Aleks [24]

Answer:

carbon if only one answer allowed, if check multiple, carbon, hydrogen, and oxygen.

Explanation:

The common elemental ingredients are carbon, hydrogen, and oxygen. They all contain the element carbon. They contain simpler units that are linked together making larger molecules.

4 0
3 years ago
Read 2 more answers
The layer inside earth that creates earth's magnetosphere is the
nata0808 [166]

Answer:

Outer Core of Earth

Explanation:

The outer layer of core of earth consists of iron as a major constituent. Due to internal high temperature and low pressure (as compared to the inner core) , the iron in this layer exists as liquid iron. Since the earth is rotating continuously on its axis, the liquid iron is also rotating thereby producing magnetic field. Due to magnetic field , this sphere of earth is known as magnetosphere.

3 0
3 years ago
Read 2 more answers
"A snail is an organism". Based on this I would expect that a snail to
kow [346]

Answer:

it's D. has cells

Explanation:

an organism is made of many different cells. what makes something not an organism is how it has no cells, and how it that can't carry out all of the basic physiological functions of a living thing. Organisms grow, adapt, respond to stimuli, and reproduce.

8 0
2 years ago
Other questions:
  • What phase is a nucleus present
    8·1 answer
  • Once the glucose molecule is split , what do we call the resulting 3 carbon structure
    10·1 answer
  • Japan is the leading producer of farm-raised shrimp, offering a lower price than Americans who farm or catch shrimp for a living
    8·1 answer
  • How many types of cells are in our bodies
    12·2 answers
  • What gel like substance between the cell membrane and the nucleus
    5·1 answer
  • What is the role of messenger RNA in transcription?
    15·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Writing your own quiz from the information you learned in class and during your reading will help improve your study skills.
    13·1 answer
  • Which area of the brain is linked to emotions such as fear.
    15·1 answer
  • Which of the following best describes how an organism inherits physical characteristics, such as eye color, from their parents?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!