The amount of water on the planet is fixed; it neither increases or decreases. Glaciers are sheets of moving ice. This water to form these extensive sheets must come from somewhere. The water comes from the most extensive store on the planet; the oceans. Ice Ages always corresponds to periods of low sea level because much of the ocean water is is land locked as glaciers.
It would be shark againts fish i think
Answer:
Sensory Evaluation
Sensory evaluation defined as the ‘systematic study of human response to physico-chemical properties’ makes it possible to obtain information about the sensitivity of the human sense and about the four dimensions of the sensory perception, i.e. the quantitative, the qualitative, the temporal and the hedonic dimensions.
Chromosomes... brainly would be great ❤️
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser