Answer:
Tropical dry Climate: The weather is sunny pretty much all year. The ocean + the sun allows a tropical place to be great for growing food. Things such as coconuts and mangoes can be found. Its a great place to vacate because of the sunny climate, also clients will fall in LOVE with the warm beaches. Some activities would be to surf, sunbathe, and study the natrual habitat. The animals are also very interesting. Monkeys and chameleons would be great temporary pets to take care of.
I hope this was good enough, god bless you!!
The haploid male (sperm) and female (egg<span>) sex </span>cells<span>; in </span>plants<span>, formed by mitosis of haploid </span>cells<span> in the gametophyte. ... The multicellular diploid portion of the </span>plant life cycle<span> resulting from the growth, mitosis, and </span>cell<span> division of a zygote. </span>Produces<span>sporangium that store haploid spores. Google*</span>
Answer:
TAAGCCGATAAATGCTAACGGTA
Explanation:
Adenine (A) pairs with Thymine (T) [Apples grow on Trees]
Cytosine (C) pairs with Guanine (G) [Cows eat Grass]
Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair
ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand
TAAGCCGATAAATGCTAACGGTA ------- New strand
The correct option is ANALOGOUS STRUCTURES.
Analogous structures are structures that are similar because of the functions they carry out and because of their external appearance. But these structures are different internally.<span />
If it’s 2x+2-y then it equal’s 10 if it’s 2x-2-y then it equals 8
