1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetllana [295]
3 years ago
13

1. care este traseul oxigenului din aer pana in creier?

Biology
1 answer:
Elza [17]3 years ago
5 0
1 bc it makes the most sedentary
You might be interested in
SOMEONE PLS HURRY HELP
Agata [3.3K]
Answer: C) Reproductive system

Detailed Explanation:

Reproduction is not considered a life process because it is not necessary to maintain life. Hence, the reproductive system is not important for an individual’s survival but is important for the continuation of that species, may it be human or any other organism.
6 0
1 year ago
An _______ of ________ during early childhood supports plasticity of the young brain, helping to ensure the child will acquire c
Vilka [71]
<span>Answer: a. overabundance; synaptic connections
</span>
In early childhood, the brain creates overabundance link of the nerve cells called synapses. The link will allow the brain cells have multiple paths to communicate with each other so that if some cells died the path is not blocked. The synaptic connections will be reduced later by a process called pruning.
3 0
3 years ago
What are 3 things that should be kept constant in a experiment?​
weqwewe [10]

Answer:

There must be an independent variable, which changes throughout the course of an experiment; a dependent variable, which is observed and measured; and a controlled variable, also known as the "constant" variable, which must remain consistent and unchanging throughout the experiment.

Explanation:

3 0
3 years ago
Read 2 more answers
What is the law of conservation of energy..
labwork [276]
Energy may change form but it can not be created or destroyed
Hope it helped
6 0
3 years ago
Read 2 more answers
Which specialized carbohydrate is used in shrimp exoskeletons?
Vesnalui [34]

Answer:

A specialized carbohydrate that is used for structure in shrimp is called chitin. Not only it is found in the shrimp cells, but also on other crustaceans such as crabs and lobsters. Chitin is a derivative of glucose and a characteristic element in the exoskeletons of crustaceans, cell walls of fungi, internal shells of squids and octopuses, and scales of fish.

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • What is one way atmospheric nitrogen can be changed into ammonia?
    9·2 answers
  • How does the endomembrane system work together with the ribosomes?. A. takes proteins out of the cell. B. provides a protective
    7·2 answers
  • Which is a function of vascular tissue
    6·2 answers
  • The food industry must always be vigilant for bacteria that can survive the methods they try to use to keep the food safe. Let’s
    13·1 answer
  • What are the learning capabilities of the different types of animals?
    12·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Territorial behavior does not extend to organisms of different species. True or False
    9·1 answer
  • It’s cooking <br><br><br> Can someone plz help me it’s due today. If you can’t read it let me know
    5·1 answer
  • Two species of birds try to eat from the same ear of corn in a field, this is an example of
    14·1 answer
  • Which answer describes basal cell carcinoma?<br><br> pls pst
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!