1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
insens350 [35]
3 years ago
5

what is false about cell division- (a)it must involve cytokinesis (b)the daughter cells form (c) it isn't performed by cancer ce

lls. (d)a cell is in G2 phase longer than it is in the G1 stage
Biology
1 answer:
Charra [1.4K]3 years ago
5 0
The answer is C; it isn't performed by cancer cells. This statement is untrue. Cancer cells are indeed capable of reproduction by cell division... in fact, according to most evidence today they appear to be better at it than normal cells.

Hope this helps!

~Ash
You might be interested in
Plants don’t move freely. How do the plant structures shown in the three images help to ensure successful reproduction? Explain
RSB [31]

The bee who is enthralled by the pollen gets some of it stuck to itself and travels with the plants offspring which ensures the plants reproduction. The wind blows the seeds of the dandelion to far off places to ensure the reproduction of the dandelion. The squirrel who is storing acorns for the winter will eat some of them, but other acorns are forgotten which ensures the reproduction of the acorn tree's reproduction.

3 0
3 years ago
Read 2 more answers
Explain in detail about Phospholipid Bilayer.
erica [24]

A phospholipid bilayer or lipid bilayer is a double layer of lipids in a cell membrane which has a hydrophobic and a hydrophilic part.

Hydrophobic - expelled by water

Hydrophilic - attracted to water

The layers form the cell membrane which means that it's functions are the same as the functions of a cell membrane, and are critic to the cells functioning.



Hope it helped,



BioTeacher101

5 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which group of organisms is missing from the food web? how do they obtain energy?
Mariulka [41]

Answer:

I think autotrophs by using photosynthesis

Explanation:

4 0
3 years ago
What element behaves MOST like magnesium?
zimovet [89]
These would be the elements in row 2 the alkaline metals. Elements in a row usually share many qualities such as electon reactivity as well as similar characteristics like the fact that many alkaline metals are considered Cations, ions with positive charges. Some examples are beryllium and calcium. 
8 0
3 years ago
Other questions:
  • Why doesn’t the sun die if it’s a star???
    13·1 answer
  • Which of the following cells is most likely to have the greatest trouble repairing damaged DNA? Which of the following cells is
    15·2 answers
  • Does waves lengths of light determine color
    12·1 answer
  • What is the function of cell selectivity Permeable plasma membrane
    11·1 answer
  • This soil structure consists of thin, flat plates of soil that lie horizontally. Usually found in
    12·1 answer
  • Is water dry or moist????
    7·1 answer
  • What is the difference between scientific theory and law?
    10·2 answers
  • Blood
    12·2 answers
  • (please help ASAP!) Chimpanzees, chickens, cows, and human beings all share a gene for an insulin hormone. What does this sugges
    11·1 answer
  • How many half-lives have lapsed to yield a sample with 125 atoms of C-14 and 375 atoms of N-14
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!