1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kykrilka [37]
4 years ago
9

How can pollution affect the food chains and the food webs

Biology
2 answers:
artcher [175]4 years ago
8 0
If there is acid rain it can kill things
VLD [36.1K]4 years ago
7 0
Pollution can effect the food chain and the food web In many ways. The first of wich is it can kill off animals. A good example of this is marine life.  
You might be interested in
Ageratum is considered which of the following flower types?
Roman55 [17]

Answer:

Filler

Explanation:

6 0
3 years ago
Efferent neurons are also called _________ neurons: they camy impulses from the CNS to muscles and glands.
algol13

Answer: d. motor

Explanation:  Efferent neurons are motor neurons. They are called efferent neurons because they transport nerve impulses out of the central nervous system (CNS) to effectors such as muscles or glands.

8 0
3 years ago
Humans and apes both belong to order primates. Therefore, humans and apes must also belong to the same
Rudik [331]
The answer is A. Class, because the divisions get smaller and smaller as they go down. Class is before Order so the division would be bigger.
3 0
3 years ago
Read 2 more answers
If a bug has 10 chromosomes in his body cell. Why will his cells have 10 chromosomes after MITOSIS?
max2010maxim [7]
Would have 20 chromosomes
8 0
3 years ago
A nurse is working in a clinic where a family member's spouse is treated for a sexually transmitted disease. the nurse is concer
Eddi Din [679]
To take precuation and inform properly about the disease and run the adequate tests to be sure of the risk that the family member runs. Hope this is useful
7 0
3 years ago
Other questions:
  • When biological membrane is frozen, it can be split along the middle of the phospholipid bilayers. Predict the effect of fatty a
    7·1 answer
  • Animals that are members of different species and share a habitat peacefully _______. likely are cooperating to catch food resou
    6·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which of the following might be affected by the loss of a plant species
    11·2 answers
  • How is cell differentiation different than mitosis?
    9·1 answer
  • What happens to your body’s motion when the bumper car you’re riding in hits a stopped car? a. Your motion stops. b. Your motion
    13·1 answer
  • Plz help mee......well mark brainliest!
    14·2 answers
  • What university recently changed its name in honor of rosalind franklin
    13·1 answer
  • There is an error in the above model.
    8·1 answer
  • Animal cells do not have cell walls. true or false
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!