1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kykrilka [37]
3 years ago
9

How can pollution affect the food chains and the food webs

Biology
2 answers:
artcher [175]3 years ago
8 0
If there is acid rain it can kill things
VLD [36.1K]3 years ago
7 0
Pollution can effect the food chain and the food web In many ways. The first of wich is it can kill off animals. A good example of this is marine life.  
You might be interested in
The cnidarians inner layer of tissue is specialized for
seropon [69]
The Inner layer of tissue is used for digestion.
6 0
3 years ago
Helppppppp my friend she struggling the pic is below
steposvetlana [31]
We have the same last name
4 0
2 years ago
Read 2 more answers
What would happen to the mountain lion population if the deer became extinct?
Fofino [41]
The mountain lion population will decrease.
7 0
3 years ago
Read 2 more answers
What type of diagram shows how energy moves in a eycosystem
Sloan [31]
A type of diagram that shows how energy moves in a ecosystem is a food chain
8 0
3 years ago
Which state of a dead body is caused by the lack of adenosine triphosphate (ATP) to the muscles?
Ket [755]

Answer:

__Rigor mortis__________ is caused by the lack of adenosine triphosphate (ATP) to the muscles

Explanation:

The rigor mortis corresponds to the stiffness of the muscles (they cannot contract or elongate) due to the lack of ATP, where I fixed the bridges between actin and myosin. This event happens when the oxygen transporting organs stop working.

7 0
3 years ago
Other questions:
  • Environmental variation:
    9·1 answer
  • Why does Florida have a large number of underwater cave systems
    13·2 answers
  • Why compounds are the building blocks of DNA macromolecules?
    5·1 answer
  • Modern organisms in similar environments often have similar physical
    10·1 answer
  • Help plzzzzzzzzzzzzzz
    5·1 answer
  • If all of the grasshoppers died or left the area suddenly, what impact would that have on this ecosystem's food web? Answer by n
    11·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • PLS HELP WILL GIVE BRAINLIEST AND 50 POINTS!!!
    12·2 answers
  • 5B
    8·2 answers
  • Which behavior is a response that is determined by heredity?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!