1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VladimirAG [237]
3 years ago
11

I NEED SOME HELP... What are ions 14 points if you answer this

Biology
2 answers:
Afina-wow [57]3 years ago
8 0

Answer:

Ions are an atom or group of atoms that either has a positive or negative charge. An ion with a negative charge is called an anion and one with a positive charge is a cation.

Hope this helps :)

Romashka [77]3 years ago
3 0
An ion is a particle, an atom or molecule. It is an atom that has a net electrical charge in which the total number of electrons is not equal to the total number of protons, giving the atom a net positive or negative electrical charge.
You might be interested in
Name and describe 5 soil properties
natulia [17]

Answer:

color

Soil can be described based on its color (yellow brown red), how light or dark it is, and how intense the color is.

Texture

Ranges from bolder size pieces to very fine clay

Structure

Describes the shape of soil clumps and how the soil particles are held together. It can look grainy, blocky, or prism shaped.

Consistency

Hardness or softness of soil measuered by its consitstency varies with moisture for example some soils have soft, slippery consiststency when there moist.

Infiltration

How fast water enters soil

Soil moisture

Amount of water in soil pours is its moisture contents scientits detemine weight loss by drying samples in a oven at 100c the weight difference is the amount mouisture in the soil

5 0
3 years ago
Human cells that have completed telophase i will each contain ________ chromosomes, which will be in a(n) ________ form.
mixer [17]

Human cells that have completed telophase i will each contain 233 chromosmes, which will be in a(n) replicated form.

What is telophase and why it is important?

The end of mitosis is known as telophase. Each chromosome has moved to one of the poles at this point. The nuclear membrane that surrounds these chromosomes forms at each of the cell's poles while the cell is compressed in the middle (in mammals) or divided by a cell plate (for plants).

Telophase is followed by Cytokinesis, or the division of the cytoplasm into two daughter cytoplasm cells. The daughter cells that result from this process have identical genetic composition.

To learn more about Telophase refer

brainly.com/question/11574154

#SPJ4

3 0
1 year ago
A physician orders aztreonam 500 mg IM tid (three times a day) for a child with a urinary tract infection. The child weighs 44 p
Mumz [18]
None bc the mother of the child said no to the medicine bc of the possible side effects. I dare you actually put that as the answer, look at the angry look on your science teacher’s face
7 0
3 years ago
A _______ is a segment of dna that contains the information necessary to express the inherited traits of an organism. protein
kicyunya [14]
Hello!
.
The answer to your question is gene/s.
.
A gene is a segment of DNA that contains the information necessary to express the inherited traits of an organism.
:)
8 0
3 years ago
Read 2 more answers
Convection heat loss reduces body temperature by way of:
lara [203]
<span>Transferring heat by moving cooler air over the body</span>
5 0
3 years ago
Other questions:
  • What are the characteristics of crustaceans,insects,and arachnids?
    13·1 answer
  • Why is there rain<br> in the sky
    11·1 answer
  • The human body is made up of different types of cells, such as epithelial cells, muscle cells, and blood cells. What process is
    5·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Why is it important that cells have a contrllol system to regulate the timing of cell division
    13·1 answer
  • What properties do alcohol and water share?
    5·1 answer
  • HIV disables the immune system by
    5·1 answer
  • Where and why are eggs produced in females?
    5·2 answers
  • Are heroes born or cultivated? What do you think and why?
    11·2 answers
  • TRNA is responsible for interpreting the mRNA codons and bringing amino acids to the ribosome, in a word this process is known a
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!