1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andre45 [30]
2 years ago
15

Which population is most likely to survive in the event of a new disease?

Biology
1 answer:
Gala2k [10]2 years ago
6 0

Answer:

A

Explanation:

I don't know if this is the answer but I think it's A because more diversity means more opinions and more opinions means more solutions to the problem at hand

You might be interested in
If a cell has 46 chromosomes, how many chromosomes will that cell have after the DNA is replicated during the synthesis phase?
IceJOKER [234]
23 individual chromosomes, 46 total. Cannot be more
4 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Alice goes to see a rerun of jaws (a movie about a vicious shark) a few days before she travels to florida for spring break. whi
astraxan [27]
The answer is priming

Priming a fear is a process that makes a person associate a condition with fear. In this case, the movie about shark attack is the cause. Alice fears the shark attack and the movie associate ocean with the shark attack. The result of the priming is Alice feeling fear in the ocean.
7 0
3 years ago
I only need help with number 2 and 3 please answer both i mark you as brainlist
kakasveta [241]

Answer:

Reading graphs: The variable plotted on the x-axis is year while the two variables plotted on y-axis are both wolves and moose.

Interpreting variables: The population of moose rose from 800 to 1550 between 1965-1972 while the population of wolves rose from 24 to 43 between 1973-1976.

inferring: The change in population of moose might cause a change in wolves population as a result of the feeding pattern of wolves, perhaps the contest between them was affected by availability of another prey which allows the predator (wolves) to feed on another prey, hence increasing the population of moose.

Conclusion: The dip in population of moose between 1974 and 1981 could be attributed to voracious feeding pattern the predator (wolves) had on the prey (moose) which inturns allows the dip in population during the above mentioned years.

Predicting: If there is a disease infection in wolves, then there would be an increase in the population of moose the next year as a result of disruption in the predator-prey contest, hence; allows one to be more populated the following year.

Explanation:

From the above assertions, it could be deduced that only when the feeding pattern of the predator (wolves) changes then the population of the prey would either be reduced or increased.

5 0
3 years ago
Which of the three major environmental problems is the most challenging because it is irreversible
drek231 [11]
Answer choices please. If there are any.

8 0
3 years ago
Read 2 more answers
Other questions:
  • About 70% of our planet is covered by oceans. Compared to the depth of the solid portion of earth, the water on Earth forms what
    8·1 answer
  • The double helix structure of DNA
    13·1 answer
  • 1. Which of the following structures is most likely to be found in an autotrophic protist?
    15·2 answers
  • What _______ will the prescription drug have on my condition? My Answer:<br> a. affectb. effect
    10·2 answers
  • The entire process of bone formation requires a number of substances, including ____________ (which enhances calcium absorption
    11·1 answer
  • In order to protect off of aquifers near landfills material is placed under the soil to prevent pollution which property must th
    10·2 answers
  • For John Milton, literature, faith, and politics were inseparable. How do Milton’s sonnets shape or reflect society?
    15·2 answers
  • How are dominant genes and recessive genes different ?
    5·1 answer
  • Scheme for Igneous Rock Identification CRYSTAL
    5·1 answer
  • Can someone help me create an island with how it was made and 5 landmarks that has a geological back story to them.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!