1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tresset_1 [31]
3 years ago
12

True or False. Biological polymers such as DNA and protein are polymers that contain

Biology
2 answers:
Hoochie [10]3 years ago
8 0

Answer:

false

Explanation:

i took a test good luck

egoroff_w [7]3 years ago
8 0
Answer

The answer is false
You might be interested in
Where can you find stem cells
Ganezh [65]

Answer: adult tissues

Explanation: Adult stem cells. These stem cells are found in small numbers in most adult tissues, such as bone marrow or fat. Compared with embryonic stem cells, adult stem cells have a more limited ability to give rise to various cells of the body.

3 0
3 years ago
What would be the tempeture of a pot of water if you continued heated it for 10 minutes after it had already started boiling?
Margarita [4]
Assuming it is plain water and had normal air pressure it would stay 100 degrees Celsius having reached its latent heat of vapouristaion the extra energy added into the water in that 10min would go into turning the water into steam. Simplified: it would stay at the same temp
8 0
3 years ago
All of these examples show evidence for evolution because they show<br> and
Natali5045456 [20]

Answer:

All of these examples show evidence for evolution because they show change over time and descent from a common ancestor

3 0
3 years ago
Read 2 more answers
Recent research on biological factors in suicide has linked it to low levels of the neurotransmitter _______ in the brain.
MAXImum [283]
The answer you are looking for is called Serotonin. Please put this as the brainiest answer thank you and hope this helped.
8 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • The part of the hair that's buried within skin is the
    5·1 answer
  • Glycolysis occurs in almost all organisms on earth. From this we might conclude that __________. Glycolysis occurs in almost all
    8·1 answer
  • Question: What
    11·1 answer
  • 5. Describe the organization of DNA in a prokaryotic cell.
    6·2 answers
  • Features that increase the likelihood of survival and reproduction by an organism in a particular environment are called
    15·1 answer
  • Most fungi are able to reproduce both asexually and sexually. Describe when asexual reproduction occurs and when sexual reproduc
    7·2 answers
  • Which answer below correctly identifies how each wave is used in cell phones
    14·1 answer
  • Which is not a function of proteins?
    11·1 answer
  • If a man has blood type AB and the woman has blood type O, what blood type would you expect the children to have?
    7·1 answer
  • Changes in DNA are called ___, which can cause a different _____ to be made.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!