1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zina [86]
3 years ago
9

What is the answer

Biology
1 answer:
iragen [17]3 years ago
3 0

Answer:

A) Dark moths had a survival advantage in rural Birmingham.

Explanation:

In the given graph, the data about dark moths are colored orange, and the data about light moths are colored green. We can clearly see this in the image I've attached below.

We can see that the percentage of recovered dark moths is greater in Dorset, while the percentage of recovered light moths is greater in Birmingham. This means that the dark moths had a survival advantage in Dorset, while the light moths had the advantage in Birmingham. This is why statement A is not supported by Kettlewell's data.

You might be interested in
Explain the adaptive value of a larger body size at high altitudes.
Vera_Pavlovna [14]
<span>it's colder the higher you go, a big body can retain heat better</span>
6 0
3 years ago
Read 2 more answers
When water is being transported from the roots to the leaves of a plant or tree, water vapor eventually escapes through air spac
miss Akunina [59]
C. cohesive forces, I'm not sure
6 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
compare the physical and chemical properties of a compound to those of the elements of which it is composed.
Inessa05 [86]

Answer:

Compound: These are made of the various type of same or different elements. These elements show a specific ratio in a particular compound.

The physical properties are traits of a particular compound or element that can be observed physically like the state of matter, color, odor, and other. The chemical properties and physical properties of compounds and elements they formed are different.

It is not comparable as the elements have no or very little individual value in a compound. For instance, water made of hydrogen and oxygen, where water is liquid and constituents are gas.

7 0
3 years ago
What does an oceanic-oceanic convergence give rise to?
elena55 [62]

It's A. Volcanic Island Arcs

5 0
4 years ago
Other questions:
  • 1. Explain why species that overlap a great deal in their fundamental niches have a high probability of competing. Now explain w
    10·1 answer
  • Do work man not fortnite duo questions
    7·2 answers
  • The mesozic era includes the _______________ period​
    14·2 answers
  • Which Two process is it Giving brainliest Please explain
    10·1 answer
  • Plz help me!!<br> This is due tomorrow!
    9·2 answers
  • What muscle contracts and relaxes when you inhale and exhale?
    11·1 answer
  • 2. Despite differences in size and shape, all cells have
    13·1 answer
  • Imagine the CCA added to the 3' end of the tRNA consisted of DNA nucleotides. It (WOULD/WOULD NOT) be possible to connect an ami
    5·1 answer
  • In general, what type of air masses and front could create a big thunderstorm?
    10·1 answer
  • A/an ____________________ is a benign fatty tumor under the skin that causes a bump.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!