1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serga [27]
2 years ago
5

Jill wants to conduct an investigation to determine what happens to the temperature of water if it is left in the sun. She place

s a container of water the sun and inserts a thermometer. She reads
the thermometer every minute and records the temperature. What is the responding (dependent) variable?
amount of sunlight
temperature of the water
amount of water
time in the sun
Biology
1 answer:
Ivenika [448]2 years ago
4 0

Answer:

Temperature of the water

Explanation:

A dependant variable is something that is affected/changed by the independent variable. The temperature of the water is changed by the amount of sunlight and time in the sun changing.

Hopefully that helps. xx

You might be interested in
A population of pigs lives on an island together with burrowing termites. Pigs that have the longest snouts tend to survive bett
Finger [1]
I believe it is ecosystem selection
3 0
3 years ago
Read 2 more answers
In the study of human evolution, scientists define modern in terms of:
Lina20 [59]

<span>Answer:  a)  a series of anatomical traits that distinguish Cro-magnon features from Neandertals.</span>

<span>Neanderthals (Homo neanderthalensis) were first discovered in Germany in 1856 and are believed to emerged between 100,000 and 200,000 years ago. </span>

<span>Significant differences found in the human and </span>Neanderthal includes<span>: 1) their DNA, 2) the brain of a Neanderthal had a raised larynx and was also bigger, and  3) Compared to modern humans, Neanderthals had bigger and muscular body but with shorter legs.</span>

Cro-magnon is<span> the earliest known Western European example of our species who lived  35,000 and 10,000 years ago. They are believed to be actually modern in every anatomical respect. They are much like us.</span>

<span>Neanderthal and Cro-magnon were believed to overlap in Europe for a thousand years but long-term interbreeding was not seen. </span>

6 0
3 years ago
Which of the statements about half-life are true?
Oksana_A [137]

The statements which are true about half-life are given below:

  • A radioactive element's half-life stays the same when its temperature changes.
  • A radioactive element's half-life stays the same when the pressure upon it changes.

Thus, the correct options are B and F.

<h3>What is Half-life?</h3>

The half-life of any radioactive element may be defined as the time taken for the radioactivity of a specified isotope to drop to half of its original value.

The above statement is true about the half-life of any radioactive element because the half-life of any substance does not depend on pressure, temperature, and concentration.

Therefore, it is well described above.

To learn more about Half-life, refer to the link:

brainly.com/question/2320811

#SPJ1

6 0
1 year ago
Which best describes the function of the endomembrane system in cells? A. transports materials throughout the cell B. provides s
earnstyle [38]
The awnser is A 

hope that helped
4 0
3 years ago
Describe how animals adapt to the desert. Be specific.
devlian [24]

Answer:

The two main adaptations that desert animals must make are how to deal with lack of water and how to deal with extremes in temperature. Many desert animals avoid the heat of the desert by simply staying out of it as much as possible. ... The kidneys of desert animals concentrate urine, so that they excrete less water. Hope this helps!!

Explanation:

8 0
2 years ago
Read 2 more answers
Other questions:
  • In 1831, Charles Darwin visited the Galapagos Islands. While observing the giant land tortoises that lived on these islands, Dar
    7·2 answers
  • Myocardial infarction indicates
    15·1 answer
  • A parasite is an organism that
    9·1 answer
  • When a refrigerator stops working, you must check the food temperature. If the temperature of the food is above _______, it must
    11·1 answer
  • Which is a process that eliminates harmful alleles from a gene pool?
    14·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Easy 10 points Species resource<br> List all the facts you can pull from the graph?
    14·1 answer
  • What is a difference between prokaryotic and eukaryotic cells?
    8·1 answer
  • A group of organs working together to achieve a common function is known as:
    9·2 answers
  • What is photosynthesis?Explain.​
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!