1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex Ar [27]
3 years ago
9

Question 1

Biology
1 answer:
RUDIKE [14]3 years ago
4 0

The answer is A stop

You might be interested in
How much water does the average american family for four users use per day in their home?
aliina [53]
The average american family uses 400 gallons of water per day in there homes........(GOODLUCK!)
4 0
3 years ago
The least-equipped organisms may not survive True False
Mademuasel [1]

Answer:

True

Explanation:

4 0
3 years ago
What enzyme catalyzes the reaction in the Calvin cycle?
Mashcka [7]

Answer:

ribulose bisphosphate carboxylase (RuBisCO)

Explanation:

The Calvin cycle is a process utilized to ensure carbon dioxide fixation. ... The carbon dioxide is combined with ribulose 1,5-bisphosphate to form two 3-phosphoglycerate molecules (3-PG). The enzyme that catalyzes this specific reaction is ribulose bisphosphate carboxylase (RuBisCO).

4 0
4 years ago
Read 2 more answers
If a mother has a blood type AB+- and her father has a blood type B- and she marries a man with O- blood type. What is the perce
Marina CMI [18]
Genetics, blood type gene has two alleles, each allele has genotype A, B or O. The A and B are dominant, and O is recessive. So allele A combined with allele O is type A. Similarly, BO is type B, AA is type A, BB is type B, OO is type O, and AB is typeAB.

If both parents have type A blood, then the alleles could be AA or AO, thus the allele A frequency is 75%, allele O frequency is 25% for both parents. 
So the chance of alleles OO is 25% × 25% = 6.25%, 
alleles AA is 75% × 75% = 56.25%, 
alleles AO is 75% × 25% = 18.75%, 
alleles OA is 25% × 75% = 18.75%.
Since AA, AO and OA are blood type A, and OO is blood type O, thus their child has 6.25% chance to be blood type O and 93.75% chance to be blood type A. 

The +/- is called the rhesus factor, with + being dominant, and - being recessive.
So if both parents are -, the kids are always -, otherwise the kids might be + or -. 

Child Blood Type Estimate Table:
Father's Blood TypeABABOMother's
Blood
TypeAA/OA/B/AB/OA/B/ABA/OBA/B/AB/OB/OA/B/ABB/OABA/B/ABA/B/ABA/B/
8 0
4 years ago
How are rainbow trout in Spirit Lake today different from those in other mountain lakes?
Novosadov [1.4K]
The correct option is this: THE TROUTS GROW FASTER BUT HAVE SHORTER LIFE SPAN.
Trouts live in fresh waters such as streams and lakes, they feed on microscopic organisms, small fish and insects. They have  a maximum length of about 35 inches and they are excellence sources of omega 3 fatty acids. Trouts have relatively short life span.
6 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How does a muti-celluar organisms organise
    7·1 answer
  • Glen is attempting to use operant conditioning to train his dog, Thor, to fetch a ball upon command. To test Thor’s understandin
    14·2 answers
  • Answer with a reason and complete sentences
    6·2 answers
  • Here is your goal for this assignment: Identify figures of speech in context Find a copy of a Bible story told in narrative form
    9·1 answer
  • Large molecule made up of amino acids
    6·1 answer
  • Why is Earth's outer core hotter than Earth’s oceanic crust? Earth’s oceanic crust is denser than Earth’s outer core is. Earth’s
    13·2 answers
  • Occurs when nearby objects obstruct the solar radiation to the PV module.​
    13·1 answer
  • घाममा सुकाउन राखीएको लुगा लौरोले पटटा धुलो झरछ किन?<br>class 9 science ​
    12·1 answer
  • What is meaning of "seedling"?​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!