1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tiny-mole [99]
3 years ago
8

Put the number by which one you answer

Biology
1 answer:
Anni [7]3 years ago
5 0
13!!!!!!!!!!!!!!!!!!!!!!!
You might be interested in
What is the fluid found in the extracellular matrix that holds cells together as tissue and allows them to communicate with one
garri49 [273]

The fluid inside of the Extracellular Matrix is Extracellular Fluid. Extracellular Fluid is also called ECF. ECF is mostly tissue fluid. It is also made up of a large amount of intravascular fluid. The remaining smaller amount of ECF is transcellular fluid.

hope i could help :)

4 0
3 years ago
Read 2 more answers
Hii everyone i have question again which substances made gages​
slamgirl [31]

What is the question???

8 0
3 years ago
What’s the correct answer for this ?
e-lub [12.9K]

Answer:

Cos(89)

Explanation:

Trust me Im right. I got this answer by calculating what decimal sin(1) is then saw which answer choice equals the same answer

3 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Cells spend time making their organelles and completing tasks such as producing protein. When during the cell cycle would a cell
notsponge [240]
D. Mitosis, During<span> the mitotic phase, the duplicated chromosomes are segregated ... reserves to </span>complete<span> the </span>task<span> of replicating each chromosome in the nucleus</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • Enzymes and antibodies have different functions, but both are types of ____________.
    5·1 answer
  • because ideas about evolution by natural selection have never been proven false what term can be used to describe evolution by n
    13·1 answer
  • ALL BUT one product of the light dependent reaction of photosynthesis is utilized in the light independent reaction. That is
    7·1 answer
  • Review:
    9·1 answer
  • When releasing the energy, which element releases longer wavelengths like red, as seen with the auroras?
    7·1 answer
  • What would happen on a hot day if your brain did not receive input that your body was starting to heat up
    7·2 answers
  • model below demonstrates The process of cell division. Identify the process being illustrated and explain how this process is in
    10·1 answer
  • Could more people be supported by 20 acres of land if they ate only plants instead of both plants and animals
    12·1 answer
  • What part of the kidney can be under hormonal control?
    7·2 answers
  • Select all properties of NONMETALS.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!