1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
uranmaximum [27]
3 years ago
11

What refers to a steady rise in the environment’s temperature?

Biology
1 answer:
vekshin13 years ago
4 0

Answer:

homeostasis, or a stable internal environment.

Explanation:

I think that this is the answer, but I'm not entirely sure.

You might be interested in
Pls help me with this giving Brainly
kow [346]

Answer:

Helping others is the characteristics of human beings.

Explanation:

It is very important to stand up for others because helping others is the property of human beings. Those people who stand for other people and help them in their difficult situation, these people helped by the God and these people get happiness and prosperity in their life while on the other hand, those people who can't stand for other people will also can't receive help from others in difficult and needy situation. This stand also shows your courage and bravery to the opposite party.

3 0
3 years ago
Tanner is convinced that the circulatory system and the immune system do not function together in humans. He did complete
Lilit [14]

Answer:

D

Explanation:

All the body's systems are linked together in some way. They all interact to produce a fully functioning organism.

A is not correct, becomes hormones are part of the endocrine system, not the immyne system.

B is not correct, because they are not explicitly involved in homeostasis

C is incorrect, all the systems are always working in the background.

The correct answer is D, one way in which the two systems are linked is that the cells of the immune system need to circulate around the body. The circulatory system is incredibly important for this, ensuring that the cells can reach their target sites

4 0
3 years ago
Lichens and mosses, followed by grasses and shrubs, slowly take root on a newly formed volcanic island. Eventually the grasses a
rodikova [14]
<span>Climax Community is the answer :)</span>
3 0
3 years ago
Read 2 more answers
How would shoot and root growth be affected by a mutation that caused plants to lose the ability to polymerize glucose into star
Anastaziya [24]

Answer:

b) Lateral branch shoots would grow more horizontally and have less of a tendency to turn upward.

d) Lateral branch roots fully embedded in soil would grow randomly upward and downward.

e) Roots breaking the soil surface would grow upward.

Explanation:

Inside the amyloplasts of the common bean the starch granules resemble variously sized cotton balls stuffed into a balloon. Under normal circumstances amyloplasts do nothing more than sit on the bottom of special gravity-sensing cells. When a plant is knocked over, the amyloplasts slide from what was recently the bottom of the cell onto a formerly vertical wall. Somehow, this movement is sensed and relayed to cells that secrete the growth-regulating plant hormone auxin.

Since the plant has lost the ability to transform glucose into the granules. The plant can´t differentiate between up or down because gravity is what causes these granules to settle down.  

4 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • When during the cell cycle do chromosomes first become visible?
    14·1 answer
  • When cells are copied using excel's copy function, what happens to the data in the copied cells?
    7·1 answer
  • How might a scientist display data on the territories of different groups of chimpanzees? What would this be an example of?
    8·1 answer
  • If a eukaryotic cell is in the G1 phase of the cell cycle, which statement about the cell’s chromosomes...?
    10·1 answer
  • The image above is of a microscope specimen In your answer explain the following:
    7·1 answer
  • Line B in the given graph represents the reaction with an enzyme added to substrates. How did the enzyme affect the reaction?
    11·1 answer
  • LOOK AT THE PICTURE!!
    13·1 answer
  • Which type of mutation plays the most important role in increasing the number of genes in the gene pool?
    14·1 answer
  • A scientist is using a karyotype to investigate a mutation in an organism. Which type of mutation would a karyotype best help to
    12·1 answer
  • Location e is located at the tropic of cancer, while location f is at the equator. which location is likely to be warmer at the
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!