1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faust18 [17]
3 years ago
10

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (59)CTTAACACC

CCTGACTTCGCGCCGTCG(39) (a) What is the base sequence of the mRNA that can be transcribed from this strand
Biology
1 answer:
gulaghasi [49]3 years ago
7 0

Answer:

GAAUUGUGGGGACUGAAGCGCGGCAGC

Explanation:

The process whereby a mRNA molecule is formed from a DNA template is called TRANSCRIPTION. The mRNA formation follows the complementary base pairing rule which says that Adenine is bonded to Thymine (Uracil in RNA) i.e A-T(U) while Guanine is bonded to Cytosine i.e. G-C.

Based on this, a DNA molecule with base sequence: CTTAACACCCCTGACTTCGCGCCGTCG will be transcribed into a mRNA strand with base sequence: GAAUUGUGGGGACUGAAGCGCGGCAGC

You might be interested in
One of the conditions required to maintain genetic equilibrium is
bonufazy [111]

Answer:

No change in the DNA sequence, No migration, A very large population size, Random mating, and No natural selection

Explanation:

those are all of the conditions. pls mark as brainliest.

6 0
3 years ago
The ____________ functions as a gateway through which chemicals and small particles, such as ____________ enter or leave the cel
Vilka [71]

Answer: cell membrane

such as water, micro-organism

physical process

simple diffusion, osmosis and filtration

such as potasssium permaganate in water,urea a liver waste diffuses from the body and the kidney help in filtering it out

physiological processs

active transport, phagocytosis and pinocytosis

such as soduim-potassium pump, exocytosis

Explanation:  transportation in and out of cell is done in different ways listed above but a barrier to this movement is the cell membrane which is an outer covering of the cell. it protect the cell and only some materials can penetrate the cell membrane e.g micro-organism, water e.t.c. the various physical and physiological processes are the various ways substance  cna be liquid, solid or gas are transported within or outside the  cell e.g food

6 0
3 years ago
How are greenhouse gasses naturally produced
stich3 [128]

Answer:

Greenhouse gases absorb this energy, thereby allowing less heat to escape back to space, and 'trapping' it in the lower atmosphere. Many greenhouse gases occur naturally in the atmosphere, such as carbon dioxide, methane, water vapor, and nitrous oxide, while others are synthetic.

5 0
4 years ago
Write the equation 3x + y = -10 in the point-slope form
tensa zangetsu [6.8K]
Y+13=-3(x-1) is the answer
5 0
3 years ago
What is the purpose of a conclusion?
Ymorist [56]

Answer:

The function of your paper's conclusion is to restate the main argument. It reminds the reader of the strengths of your main argument(s) and reiterates the most important evidence supporting those argument(s).

Explanation:  step-by-step mark most brainliest pls

8 0
3 years ago
Other questions:
  • The ductus arteriosus allows fetal blood to move from the
    7·1 answer
  • How do DNA, chromosomes, and genes work as the instructions for heredity?
    12·1 answer
  • Atp synthesis in chloroplasts is very similar to that in mitochondria: electron transport is coupled to the formation of a proto
    11·2 answers
  • Name some short-term changes
    5·1 answer
  • the nerve pathway linking the heat receptor in the hand with the arm muscle is about 1.5 meters in length. it would take the ner
    14·1 answer
  • What is the function of the nucleus in plant and animal cells? A. Produces all the power of the cell B. Creates proteins within
    12·2 answers
  • How is gravity related to Newton’s 1 law of motion
    14·1 answer
  • What are the main factors that<br> determine Earth's climate?
    8·2 answers
  • Which is the BEST explanation for the drastic decrease in the number of dolphins killed after 1975?
    9·1 answer
  • Angiosperms are more advanced than gymnosperms because gymnosperms lack which structure found in angiosperms?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!