1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lera25 [3.4K]
3 years ago
15

If humans change the function or equilibrium of one of Earth's systems, this will not change

Biology
1 answer:
joja [24]3 years ago
6 0

Answer:

False.

Explanation:

All of the things found in the Earth system can be categorized into four (4) main categories and these includes;

I. Land: this subsystem forms a sphere which is generally referred to as litosphere.

II. Water: this subsystem forms a sphere which is generally referred to as hydrosphere. It comprises of landforms such as mountains, valleys, plateaus, ridge, rocks, etc.

III. Air: this subsystem forms a sphere which is generally referred to as atmosphere. This sphere comprises of gases such as oxygen, carbon dioxide, nitrogen, etc.

IV. Living organisms: this subsystem forms a sphere which is generally referred to as biosphere. It comprises of all living things such as humans, animals and plants.

If humans change the function or equilibrium of one of Earth's systems, this will significantly change the function or equilibrium of all of Earth's systems. Consequently, these changes result in environmental phenomenon such as volcanoes, earthquakes, tornadoes, wildfire, etc.

You might be interested in
Analysis of a blood sample from a fasting individual who had not eaten for 24 hours would be expected to reveal high levels of _
saw5 [17]

Answer:

Glucose

Explanation:

As since no other foods are found such as carbs the body breaks down the stored glycogen to produce glucose.

If you want to know the process of how the glucose is made pls comment.

7 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Abiotic factors that best describe a coniferous forest.
Gwar [14]
Precipitation, soil, temperature, humidity, and altitude 
8 0
3 years ago
Read 2 more answers
What would be the effect on blood flow if some arteries lost their elasticity?
viktelen [127]

c because the elasticity of arteries allow them to expand and contain more blood in them.

Hope this helps :)

3 0
3 years ago
In plants and animals, gene flow can occur between closely related species. This is Called...
xxMikexx [17]
A) 2 related species = hybrid
3 0
3 years ago
Read 2 more answers
Other questions:
  • Why does secondary succession occur faster than primary succession?
    10·1 answer
  • Once pathogens have penetrated the non-specific barriers, they are confronted by macrophages and natural killer cells. how do th
    13·1 answer
  • What is the dependent variable in this experiment
    10·2 answers
  • How does the impact of the virus differe between lytic and lysogenic cycles?
    8·1 answer
  • Where does the life in the forest start
    13·1 answer
  • Hair analysis may be used to determine all of the following except.
    8·1 answer
  • Since plant matter generates heat as it decomposes, where would a fire be most likely to start in the piles of grass?
    11·1 answer
  • Where do decomposers get their energy from A)sun B)plants C)dead plants and animals D)humans
    11·2 answers
  • Please can i get some help (; <33
    9·2 answers
  • Need help on this question
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!