Answer:
I the organelle goes to the second row on the left
The right answer for the question that is being asked and shown above is that: "-an extrusive igneous rock." Darby finds a rock in her backyard. It has large crystals. She has found <span>-an extrusive igneous rock</span>
I think it is “D. More specific”
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
