1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
12

Assembling a complete sequence from fragment sequences

Biology
1 answer:
Soloha48 [4]3 years ago
7 0

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

You might be interested in
Explain the reasons for changes in how organisms are classified.
san4es73 [151]
<span>Organisms used to be classified in the earliest times according to their size. As science progressed, they started getting organized by their physical traits and now they're organized by traits found in their species that are not found in others based on the theory of evolution. They are classified according to how they developed from a starting organism.</span>
4 0
3 years ago
Read 2 more answers
Eukaryotic cells are differentiated from prokaryotic ells because eukaryotic cells
liberstina [14]
I know all about this, but could you specify what you mean?
4 0
3 years ago
Suppose that after 22 months, guppies from the transplanted population were returned to the source pool. What would most likely
hammer [34]
<span>When organisms are born in the wild, they tend to start developing an understanding of their surroundings based on their experiences. If an organism is transplanted to a different environment right after birth, it will develop the instincts to survive in that environment. A sudden change in its environment will result in the organism being out to place, possibly unable to cope with the selection pressures of its new environment. This will likely be the case with these guppies. This issue with transplantation is very real with animals born in captivity, which is why many are put through simulation exercises such as hunting and hearing the calls of predators, so that they may be able to survive in the wild, when transferred.</span>
8 0
3 years ago
Which level of organization is best represented by the liver?
siniylev [52]

Answer:

Organ level– an organ is a structure composed of at least two different tissue types that perform a specific function within the body. Examples include the brain, stomach, and liver. Complex functions begin to emerge at this level.

Explanation:

3 0
3 years ago
Peat contains acids that can help fight diseases.<br> True<br> False
siniylev [52]

Answer:

false

Explanation:

The reason why its false is because a person can't fight diseases with acids. there is something your body has called Antibodies. Also acid would only make it worse

5 0
3 years ago
Other questions:
  • Binary fission
    10·1 answer
  • Which statements describe the cell membrane? Check all that apply.
    10·1 answer
  • What does RDP stand for in cellular biology?
    6·1 answer
  • What percent of the females will have red eyes
    5·1 answer
  • Which of these resources are renewable? Check all that apply.
    6·2 answers
  • Where is the active site located on the enzyme?
    15·1 answer
  • What is the role of dystrophin in normal muscles? How is the different in DMD muscles?
    14·1 answer
  • How long does it take for a dog to heal from neutering
    12·2 answers
  • The partial pressure of oxygen in arterial blood is approximately:.
    6·1 answer
  • sub-saharan africans show the largest genetic diversity of any human population. this is likely to have resulted from a. a small
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!