1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
12

Assembling a complete sequence from fragment sequences

Biology
1 answer:
Soloha48 [4]3 years ago
7 0

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

You might be interested in
4. Why can you find different features at an
goblinko [34]

Answer:

Because of the change in density. Oceanic-continental convergance allows for 1 plate to slide under while continental to continental can not slide under and thus they collide froming features like mountins  and other stuff.

explanation:

5 0
3 years ago
What does DNA contain A.the chromosomes that build proteins B.the coded blueprint C.the ability to translate RNA code D.the fact
inn [45]

D. The factors for heredity called alleles

DNA is an acid in the chromosomes in the center of the cells of living things. DNA determines the particular structure and functions of every cell and is responsible for characteristics being passed on from parents to their children.

An allele is a viable DNA coding that occupies a given location on a chromosome.

8 0
3 years ago
Where does anaerobic respiration occur in the cell?
nirvana33 [79]

Answer:

cytoplasm

Explanation:

8 0
2 years ago
What are the uses of the energy provided by ATP in the living cells?
kkurt [141]

Answer:

ATP functions as the energy currency for cells. It allows the cell to store energy briefly and transport it within the cell to support endergonic chemical reactions. The structure of ATP is that of an RNA nucleotide with three phosphates attached.

5 0
3 years ago
During transcription the DNA base sequence is transcribed into a complementary mRNA sequence. A codon table like the one shown b
xxMikexx [17]

Answer:

b. Even though the DNA sequence changed, the sequence still codes for the same amino acid, so no change in phenotype will occur.

Explanation:

There is redundancy in the genetic code. That means that different codons can code for the same amino acids, so some mutations do not change the amino acid sequence of the protein.

Here, the amino acid is unchanged with the mutation.

If the amino acid sequence of the protein is the same, then the protein is not changed, so there will be no change in the phenotype

5 0
3 years ago
Other questions:
  • Biology..please help..TYVM
    13·2 answers
  • How is negative feedback related to homeostasis
    8·1 answer
  • Dinfenfenfujefebfue.
    13·1 answer
  • When a gasoline engine burns gasoline, what type of chemical reaction is occurring?
    15·2 answers
  • What does it mean for a virus to mutate
    8·1 answer
  • 12
    13·2 answers
  • Whoever answers I will mark brainlest
    11·1 answer
  • Pick one part of interphase in the diagram above and describe its function in the cell cycle. Explain why interphase is importan
    8·1 answer
  • What are some examples of internal structures that allow organisms to survive in their environment?
    10·2 answers
  • Which derived characteristics do tigers and lizards have in common
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!