1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
12

Assembling a complete sequence from fragment sequences

Biology
1 answer:
Soloha48 [4]3 years ago
7 0

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

You might be interested in
What is the process that divides the cell nucleus and nuclear material?
ASHA 777 [7]

Answer:

Mitosis

Explanation:

Mitosis is a process of nuclear division in eukaryotic cells that occurs when a parent cell divides to produce two identical daughter cells. During cell division, mitosis refers specifically to the separation of the duplicated genetic material carried in the nucleus.

6 0
3 years ago
Read 2 more answers
Can you describe how a researcher might use naturalistic observation, case studies, and survey research to investigate gender di
Sati [7]

Answer:

The specification of the circumstance is characterized underneath in the interpretation category.

Explanation:

  • To continue investigating differences between men and women throughout the aggressive behavior of employees, a research scientist can use observation methods, research papers, or observational studies.
  • The naturalistic observation was being used without people's awareness to classify the actions of persons throughout the natural world. In this, the researcher examines individuals for some violent actions and often examines gender disparities throughout this workplace climate with aggressive behavior.
  • Throughout the case research, the researcher does a throughout-depth study on gender disparities mostly in current workplace violent behavior. Here also, not only would the researcher observe the behavior, and address questions about the gender gaps between the departments.
  • The investigator focuses on collecting information about the number, spread, and interrelationships of gender disparities throughout the large population through survey studies.

Hypothesis:

  • <u>Research hypothesis (H1): </u>There seems to be a correlation among both gender differences but instead aggressive performance in the workplace.
  • <u>Null hypothesis (H0):</u> There seems to be no correlation regarding disparities in gender as well as violent work performance.

Research approach:

Qualitative descriptive research design could be employed throughout the descriptive research. In all of this, more attention is put on gathering knowledge about prevalence as well as the interconnection of gender disparities with occupational violent behavior. In this, this same data will be gathered by face-to-face interviews, questionnaires on genetic factors, and occupational hostile behavior.

5 0
3 years ago
How do tornadoes form.
jeyben [28]

Answer:

Most tornadoes form from thunderstorms. You need warm, moist air from the Gulf of Mexico and cool, dry air from Canada. When these two air masses meet, they create instability in the atmosphere. ... Most strong and violent tornadoes form within this area of strong rotation.

Explanation:

3 0
3 years ago
Read 2 more answers
Kingdom of organisms that have cell walls and chloroplast
just olya [345]

I only know that it sounds like a plant cell which is a eukaryotic cell.

8 0
3 years ago
The root word cyto means _____. heart cell bladder disease
Mice21 [21]
The root word cyto means "cell".
3 0
3 years ago
Read 2 more answers
Other questions:
  • Differences between a palisade cell and a fungal hypha
    6·1 answer
  • Several species of leopard frogs are common throughout North America, where their ranges overlap. Different species of leopard f
    6·1 answer
  • Which human body systems are involved in thermoregulation
    11·1 answer
  • What’s the answer to 17,18,19 please
    10·1 answer
  • Fertilizer and cell difference ​
    8·1 answer
  • Animals in Cestoda have: Group of answer choices septa and parapodia proglottids and no digestive system a pharynx and gastrovas
    7·1 answer
  • How does an iron nail change after being exposed to the oxygen in the air over a long time? Question 24 options: It burns It dec
    9·1 answer
  • What is required for LIGHT DEPENDENT reactions to occur in plants?
    14·1 answer
  • A type of asexual reproduction
    14·1 answer
  • Meeting URL: /ucx/fnfp/nay to clear doubts ​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!