1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
12

Assembling a complete sequence from fragment sequences

Biology
1 answer:
Soloha48 [4]3 years ago
7 0

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

You might be interested in
I need an answer to thos anyone willing to help?​
Artyom0805 [142]
I could try and help
5 0
3 years ago
I'll give you a Brainliest for correct answer
Ymorist [56]

Answer:

Nondisjunction causes it

......

7 0
3 years ago
Which element is necessary to complete the graphic organizer?
weeeeeb [17]
Subordinate clause I just took test
5 0
3 years ago
Read 2 more answers
Who devised a technique for determining the blood group of a dried bloodstain, which he applied to criminal investigations?.
Dominik [7]

Landsteiner Bertillon devised a technique for determining the blood group of a dried bloodstain, which he applied to criminal investigations.

<h3>What about blood group?</h3>
  • According to the presence or absence of antibodies and hereditary antigenic compounds on the surface of red blood cells, blood is classified according to its type.
  • Depending on the blood group system, these antigens could be proteins, carbohydrates, glycoproteins, or glycolipids.
  • The genes that a person got from their parents determine what blood type they have.
  • There are numerous systems for classifying blood types, but ABO is the most popular one.
  • The ABO group is divided into four main categories: A, B, O, and AB.
  • There are eight more blood types within these groupings.
  • Each of the eight blood types has a particular ability to save lives.
  • The majority of people (37% of the population) have the blood type O+, which is the most prevalent. This indicates that there is a greater need for this blood type for blood transfusions.

Learn more about blood group here:

brainly.com/question/15289194

#SPJ4

6 0
1 year ago
The fact that cats and humans are both classified as mammals provides us with which minimum of information?
Aleks04 [339]

Answer:

a. option :both have mammary glands is the correct answer right no

5 0
2 years ago
Other questions:
  • What is a leading cause of death that is found in male american indian alaska natives but not in females?
    11·2 answers
  • What is the total of magnification if you were using a 40x objective?
    6·1 answer
  • Which region of the sun is brightest in x-ray and uv images?
    15·2 answers
  • Describe the process of natural selection.
    10·1 answer
  • Which of these could represent the second step of inquiry?
    5·1 answer
  • Which flow chart best shows the relationship between the cell structures that are listed?
    12·1 answer
  • When Mary was young, her father was trying to learn how to speak German and would listen to German tapes for hours in her presen
    7·1 answer
  • Which are true of electromagnetic waves? Select all that apply.
    7·1 answer
  • Through the process of meiosis, sex cells are produced that are what?
    10·1 answer
  • Which statement about cell division is not accurate?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!