1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
4 years ago
12

Assembling a complete sequence from fragment sequences

Biology
1 answer:
Soloha48 [4]4 years ago
7 0

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

You might be interested in
The statement force equals mass times acceleration is Newton second law of motion.why is this law rather than a theory
ololo11 [35]

Answer:

The statement “force equals mass times acceleration” is Newton's second law of motion. It is a law rather than a theory because it states, rather than explains, the relationship between the variables.

Explanation:

5 0
4 years ago
What is the function of Kupffer cells in the liver?
Vera_Pavlovna [14]
The Kupffer cells protect the liver from bacterial infections
5 0
1 year ago
Read 2 more answers
HELP PLS!!!!!!!!!!!!
Ugo [173]
C. I believe this is correct
8 0
4 years ago
To compare the relative ages of fossils, scientists sometimes use an easily recognized
Natalka [10]
<h2>Answer:</h2>

The fossil is <u>A) </u><u>Index fossil</u>.

<h2>Explanation:</h2>

Index fossils refer to the type of fossil which is used to characterize and distinguish geologic periods. Due to this function of index fossil, they are also called as guide fossil or indicator fossil.  These fossils must have a short vertical range, wide geographic circulation, and quick developmental patterns.

Another term, Zone fossil is utilized when the fossil have every one of the characters expressed above with the exception of wide topographical dispersion, they are restricted to a zone and can't be utilized for relationships of stratas.

7 0
4 years ago
PLEASE HELP!!!!
Fynjy0 [20]
It is 3, just because he doesn’t have it, doesn’t mean he isn’t a carrier for it
4 0
4 years ago
Read 2 more answers
Other questions:
  • A student is investigating the affect of different salts on melting points. Four patches of ice of equal size are roped off and
    6·2 answers
  • During which month would you have the most time to devote to freelance floral projects? A. October B. September C. November D. D
    15·1 answer
  • If glucose is absent, but so is lactose, the lac operon will be ________.
    6·2 answers
  • Which organelle helps to make proteins and may be found free floating or attached to the endoplasmic
    14·1 answer
  • Corn planted in a field that has been previously planted with legumes and then plowed under is likely to be
    7·1 answer
  • The function of a plant's cambium layer is to (1 point)transport water. transport nutrients. produce food. produce new cells.
    11·2 answers
  • What would earth lack of earth didn’t have a liquid outer core?
    9·2 answers
  • Which of the following is a cost of urban development?
    14·2 answers
  • A herd of cattle is an example of
    12·1 answer
  • The anther contains (a sepals (b ovules (c caroled. Pollen grain
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!