Assembling a complete sequence from fragment sequences

Biology

1 answer:

Soloha48 [4]3 years ago

7 0

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

You might be interested in

To separate hucks and grains in field a) tailor b) grocer c) farmer d) watchman

inn [45]

Answer:

Explanation:

Comment its correct or not correct please

5 0

3 years ago

Help please ?!??????

babunello [35]

Bro I think it's A

Gravitational pull comes from the core. How rotated u are won't matter, but how far u are from the core will matter.

6 0

3 years ago

Which represents the size of a population?

Kryger [21]

Answer:

D. number of individuals in a species

8 0

4 years ago

Segments of ________ transferred from parent to offspring are called genes.

luda_lava [24]

Answer:

DNA

Explanation:

the parent's DNA are in the genes so when they get transferred, their offspring receives them.

5 0

3 years ago

List the five conditions that disturb genetic equilibrium in a population. Explain.

Ivan

No gene mutations occurring at that locus or the loci associated with the trait 
• A large population size • Limited-to-no immigration, emigration, or migration (genetic flow) 
• No natural selection on that locus or trait 
• Random mating (panmixis) It can describe other types of equilibrium as well, especially in modeling contexts.

6 0

3 years ago