1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
12

Assembling a complete sequence from fragment sequences

Biology
1 answer:
Soloha48 [4]3 years ago
7 0

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

You might be interested in
HELPP MEEE ASAPPP NOWWWWW
balu736 [363]
6.Force is necessary to get something moving.
7.An axle
8.energy
4 0
3 years ago
The compound sodium chloride is formed by which kind of bond? Covalent bond ionic bond hydrogen bond sodium bond
ehidna [41]

<u>Answer</u>: Ionic bond

<u>Explanation</u>:

  • An ionic bond is a type of a chemical bond formed by the complete transfer of electrons from one atom to another atom i.e one of the atoms loses its electrons and the other gains it. This results in the formation of 2 oppositely charged ions.
  • In sodium chloride, sodium loses one electron from its outermost shell (valence shell) whereas chloride gains it. Due to this sodium gains, a net positive charge and chloride gain a net negative charge.
  • So, due to the complete transfer of electrons that takes place from sodium to chloride, the compound generated (Sodium chloride) has an ionic bond.
7 0
3 years ago
Explain why scientirsts concluded that the instructions for species characteristics were carried in DNA.
siniylev [52]

Answer:

Explanation:

Deoxyribonucleic acid is said to contain instruction for species characteristics because it carries the information that characterize an individual.

DNA are made up of Nitrogenous bases that are unique codes specify by an individual and no two person has the same the DNA.

Genes are genetic information or instruction that specify an individual. it is located in the chromosome in the nucleus. DNA contains gene which helps to make molecules called proteins. It is the basis of all inheritance and the expression of the gene is what produces the phenotype that is visible.

7 0
3 years ago
State at least <br>5 importance of soil to agricultural​
andriy [413]

Answer:

Soil health is fundamental for a healthy food production. It provides essential nutrients, water, oxygen and support to the roots, all elements that favor the growth and development of plants for food production

Explanation:

3 0
2 years ago
5 ways education can affect sexual reproductive health
erastova [34]

Answer:

They teach you the purpose of condoms (or you learn the hard way.)

how to prevent stds

Explanation:

That's all I can think of.

8 0
3 years ago
Other questions:
  • Which situations would involve classification? Check all that apply. performing an analysis of an individual’s blood identifying
    8·2 answers
  • Which would least likely result from a chromosomal change?
    12·2 answers
  • Molecule found in muscle cells: used for structure.
    6·1 answer
  • 8. Albinism is a harmful mutation where animals are completely white. This mutation is harmful because individuals are more easi
    15·1 answer
  • Lichens result from Symbiosis between a fungus and
    6·2 answers
  • Do you think that the deer only uses the energy that is made by the plant using sunlight?
    12·1 answer
  • 12.36Un balón lleno contiene 12 kg de oxígeno, O2, bajo una presión ma-nométrica de 40 atm. Determine la masa de oxígeno que se
    9·1 answer
  • A green plant is exposed to bright light for 72 hours. What do you predict will occur if the light intensity around the plant is
    15·1 answer
  • How can plasmids differentiate species and can you tell by looking at it?
    8·1 answer
  • Which of the following shows the levels of organization in correct order from simplest to most complex?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!