1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
12

Assembling a complete sequence from fragment sequences

Biology
1 answer:
Soloha48 [4]3 years ago
7 0

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

You might be interested in
Which factor does not help determine whether a volcanic eruption will be explosive or relatively quiet?
Zinaida [17]
The factor that does not help determine whether a volcanic eruption will be explosive or relatively quiet is the composition of the lava.
On the other hand, the composition of the magma, the temperature of the magma, and the amount of dissolved gases in the magma are quite important for determining this.
6 0
2 years ago
Read 2 more answers
Countable and uncountable noun ten examples​
Nadusha1986 [10]

Answer:

Countable:  dogs, cats, sheep, trees, roads, signs, men, women, planets, universes

Uncountable:  rain, water, dirt, flour, wine, wood, plastic, glass, dust, grass

Explanation:

8 0
3 years ago
Read 2 more answers
How do the frequencies of infrared and ultraviolet light compare?
Marrrta [24]
Infrared has a lower frequency than ultraviolet light.
3 0
3 years ago
Read 2 more answers
This biome has cactus plants, less rainfall, and more sand. A) savannah B) desert c) tundra​
Paha777 [63]

Answer:

B) desert

Explanation:

good luck have a nice day

7 0
2 years ago
Read 2 more answers
The nucleus, which directs cellular activities, is separated from the cytoplasm by
Paha777 [63]

The Nucleus is separated from the cell’s cytoplasm by a membrane. The nucleus contains hereditary materials made of plenty proteins and DNA. The nucleus directs all cell activities. Nucleus is commonly found in Eukaryotic cells. The genetic materials found in the Nucleus is organized as DNA molecules, together with a wide array of proteins, which causes to form chromosomes.

6 0
3 years ago
Other questions:
  • The layer of the earth where mantle convection occurs and on which the earth's crust rests is the
    15·2 answers
  • Why is meiosis important for organisms
    13·2 answers
  • A weather station predicts that warm, humid air will pass over much cooler land during the early morning hours. Which precaution
    12·2 answers
  • Telegraphy remained the major technology for intercontinental communication well into the ________.
    11·1 answer
  • Which type of neuron allows someone to feel when raindrops fall on his or her arm?
    9·1 answer
  • The recovery process is used to
    7·1 answer
  • When a wave reaches a beach or coastline, it releases a burst of energy that generates a current, which runs parallel to the sho
    7·1 answer
  • Puffins live in the Arctic. Penguins live in the Antarctic. Suggest reasons why puffins and penguins are both similar and differ
    11·1 answer
  • Can you plz answer this that will be lovely thank you (:
    6·1 answer
  • The cells of a fish are 98% water. The fish is placed in a tank that is 96.5% water and 3.5% solute. What will happen to the fis
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!