1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
12

Assembling a complete sequence from fragment sequences

Biology
1 answer:
Soloha48 [4]3 years ago
7 0

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

You might be interested in
what will be the result of photosystem II being exposed to less sunlight more glucose molecules will be produced
melisa1 [442]

Fewer hydrogen ions will be pumped into the Thylakoid when photosystem II being exposed to less sunlight more glucose molecules will be produced.

Photosystem II is the first membrane protein complex in oxygenic photosynthetic organisms in nature. It produces atmospheric oxygen to catalyze the photo-oxidation of water by using light energy. It oxidizes two molecules of water into one molecule of molecular oxygen.

Photosystem II the energy derived from absorption of photons is used to split water molecules to molecular oxygen and protons. The most important function of photosystem II (PSII) is its action as a water-plastoquinone oxido-reductase. At the expense of light energy, water is split, and oxygen and plastoquinol are formed.

To learn more about Photosystem II , here

brainly.com/question/13211869

#SPJ4

8 0
2 years ago
How many different nutrients does you body require?<br> a. 3<br> b. 6<br> c. 10<br> d. 40?
Serggg [28]
The answer is 6 according to my reaserch 6 nutrients are essential to the body. It helps build up your health with mainly 6 main nutrients
5 0
3 years ago
The Punnett square shows the possible genotype combinations of two parents who are homozygous for a trait.
anzhelika [568]
Heterozygous refers to a pair of alleles in which one is dominant and one is recessive. As you can see, all genotypes for possible offspring in the Punnett square are heterozygous. This means the probability of the parents having a child that is heterozygous is 100 percent likely.

Answer:
<span>D. 100%
</span>
6 0
3 years ago
Read 2 more answers
Chromosomes contain different amounts of:
Juli2301 [7.4K]

Answer:

DNA srry if im wrong

Explanation:

8 0
2 years ago
Read 2 more answers
Evolution refers to which of the following?
slava [35]

Answer:

having traits that help a single organism survive

4 0
3 years ago
Read 2 more answers
Other questions:
  • How does a hydrometer work?
    13·1 answer
  • Co2 is taken through tiny holes called
    12·2 answers
  • The lava released by a volcanic eruption separates two populations of a species of monkey. What does this represent?
    11·2 answers
  • All the stars circled are the same size and give off the same amount of light. Which statement below do you agree with most? A.
    14·2 answers
  • he majority of Earth's atmosphere is nitrogen, N2. The percentage of nitrogen in Earth's atmosphere remains constant as prescrib
    10·1 answer
  • How are wastes carried to the kidney for removal?
    11·1 answer
  • Select the correct answer.
    12·1 answer
  • What cell part contains an organisms genome?
    14·1 answer
  • What are some ways that living things can be classified? What characteristics should we look at when putting living things into
    7·1 answer
  • In this activity, you will write a description of the terrarium model you created to represent the different systems (spheres) o
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!