1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
4 years ago
12

Assembling a complete sequence from fragment sequences

Biology
1 answer:
Soloha48 [4]4 years ago
7 0

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

You might be interested in
12. Fluid_
Alona [7]

Answer:

B

Explanation:

8 0
3 years ago
Read 2 more answers
Is a stage of infection in which there is few or NO
Lana71 [14]

i think the answer should be asymptomatic

8 0
3 years ago
Read 2 more answers
The sun is best described as
tangare [24]
The sun is a very big star that was created by many minerals and every star and put together
8 0
3 years ago
Read 2 more answers
Which of the following most likely represents a prototype for the concept indicated in parentheses?
garri49 [273]

Answer:

A golden retriever.

Explanation:

Prototype may be defined as the member among the group that is characterized as more central than the other member of the group. Prototype can be used in the taxonomy as well as in the evolutionary history as well.

The prototype is the main representative member of the group. The golden retriever dog is the most common member among all the members listed in the question. Hence, the golden retriever (dog) is considered as the prototype.

Thus, the correct answer is option (e).

7 0
4 years ago
Will upvote please help
atroni [7]

Answer:12

Explanation:its the only one under 18

5 0
3 years ago
Other questions:
  • Put the protein digestion steps in order of their occurrence during the digestive process.
    15·1 answer
  • Select the most appropriate statement with respect to cellular respiration in humans.
    9·1 answer
  • In a cell with defective chaperones, Question 14 options: proteins would not be able to exit the ribosome. the concentration of
    12·1 answer
  • How many amino acids differ between the monkey and the human sequences?
    5·1 answer
  • * What is one of the bigger problems of handwriting analysis? *
    12·1 answer
  • A man of healthy weight may have, on the average, ____ percent of his body weight as fat.
    9·2 answers
  • When would anaerobic respiration be used instead of aerobic respiration?
    10·1 answer
  • How do humans get energy from food?
    12·1 answer
  • What the answer pls science
    7·1 answer
  • What are the four types of motion?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!