1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miss Akunina [59]
3 years ago
15

Someone help me please :)

Mathematics
1 answer:
igor_vitrenko [27]3 years ago
3 0

Answer:

<h2><u><em>mark me as brilliant ~_~</em></u></h2>

Step-by-step explanation:

You might be interested in
Four people recorded the miles they drove and the time they spent driving. The table below shows
Irina-Kira [14]

Answer:

C: Charles

Step-by-step explanation:

165 miles divided by 6 hours

165/2.5

66 miles in one hour

8 0
3 years ago
Which of th following is a solid bounded by the set of all points at a given distance from a given point ?
aleksandrvk [35]
C.Sphere is your answer it is bound to all it's points
4 0
3 years ago
The sum of two consecutive integers is 131. What are the integers?
Dahasolnce [82]
X, x+1
x+x+1=131
2x+1=131
2x=131-1=130
x=130÷2 = 65
the integers are 65 and 66
3 0
3 years ago
Use a property of equality to solve this equation 4.5x=18
algol13

Answer:

x=4

Step-by-step explanation:

8 0
3 years ago
The cable company charges $30 to install new supplies at your house. Each month the cable bill is $75. Which equation models the
Anna11 [10]
Equation: $30+$75m
M=per month
5 0
3 years ago
Read 2 more answers
Other questions:
  • What is 10 to the negative fifth power
    9·1 answer
  • Isabella has 40 m of fence with which to build a rectangular horse corral. What is the maximum area she can enclose? Enter your
    11·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Anyone know this i need help this is for a final
    9·1 answer
  • Use the distibutive property to simplify expression 27-9x+15y
    5·1 answer
  • James is four years younger than Austin. If three times James age is increased by the square of Austin's age, the result is 28.
    5·1 answer
  • Help me with this math problem i don’t understand it
    10·1 answer
  • F(x)= 3+ 2x<br> if polynomial what is the degree?
    12·1 answer
  • Ms. Mendez ate 18 red skittles, which represented 24% of the entire packet. How many skittles were in the entire packet?
    9·1 answer
  • Lin is shopping for a couch with her dad and hears him ask the salesperson, "How much is your commission?" The salesperson says
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!