1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
belka [17]
3 years ago
10

Which two factors are most likely to cause a plants guard cells to open its stomata.

Biology
2 answers:
wlad13 [49]3 years ago
6 0

Answer:

Guard cells perceive and process environmental and endogenous stimuli such as light, humidity, CO2 concentration, temperature, drought, and plant hormones to trigger cellular responses resulting in stomatal opening or closure.

Explanation:

avanturin [10]3 years ago
4 0

Answer: The answer is in the picture

Explanation:

espero que esto ayude <3

Hope this helps <3

You might be interested in
WILL MARK BRAINLIEST! (= 20 Points)
erastovalidia [21]

Answer:

1.Carbon dioxide is converted to sugar used for food. - 1. Location- A

2.Carbon trapped in fossil fuels is converted to carbon dioxide. - 2. Location- C

3.Organic carbon is converted to fossil fuels. -3. Location- E

4.Carbon dioxide is converted to carbonates.- 4. Location- D  

5.Sugar is broken down and converted to carbon dioxide.  - 5. Location- F

Explanation

1. Carbon dioxide is converted to sugar used for food: The carbon dioxide is converted into sugars by the process of photosynthesis, which occurs in the green plants. Plants trap carbon dioxide and sunlight from the atmosphere, to synthesize their food.

2. Carbon trapped in fossil fuels is converted to carbon dioxide: The fossil fuel produced deep inside the earth, acquired by the factory. From the factory the carbon dioxide liberated to the atmosphere.

3. Organic carbon is converted to fossil fuels: The organic carbon obtained after the degradation of organic matter is responsible for the synthesis of fossil fuels.

4. Carbon dioxide is converted to carbonates: The carbon dioxide from the atmosphere gets dissolved with water of the water body and termed as carbonic water.

5.Sugar is broken down and converted to carbon dioxide: The glucose or sugar as a source of food in plants gets broken down into carbon dioxide and water by the process of respiration.

5 0
3 years ago
in animal muscular movement is caused due to change in position of proteins how do you think movement will be brought about in t
Colt1911 [192]

<u>Answer:</u>

<em>Movement will be brought about in touch me not plants by the action of various chemicals present at the base of the leaf stalk. </em>

<u>Explanation:</u>

<em>The leaves of touch me not plant stay upright due to turgor pressure. </em>It is exerted by the water present within its cells. This pressure applies force against the cell wall enabling the plant to remain stiff.  

When there is an external disturbance , parts of the plant releases certain chemicals including potassium ions that causes water to diffuse out of cells. <em>This releases the turgor pressure and causes the leaves to shrink.  </em>

7 0
3 years ago
A gas station has been robbed. The crime scene investigators arrived at the crime scene with forensic lamps to seek latent finge
Kay [80]
Fluorescence technique
8 0
3 years ago
There are several different kinds of aquatic ecosystems. Bogs get their water from precipitation, so they don't have many Fill i
Ratling [72]
  1. Bogs get their water from precipitation, so they don't have many <u>nutrients</u>.
  2. Marsh plants are adapted to waterlogged <u>soil</u>
  3. Swamps have <u>plants like trees and shrubs</u>.
  4. Rivers always have flowing currents and pick up <u>sediment</u> as they flow.
  5. Lakes are bodies of water on land.  
  6. Wetlands act as filters for nutrients and pollutants dissolved in the water.
  7. Estuaries are wetland regions where freshwater rivers mix with ocean water.

Explanation:

A wetland is a biome which has both water and land that are intermixed in various ways. According to the type of the wetland, the ecosystem differs.

Bogs: Wetland with water from precipitation and no inflow or outflow of surface or ground water.  

Soil: Acidic, infertile with less nutrient content

Vegetation: Acid-loving plants

Swamps: Forest wetlands near rivers and lakes.

Soil: well draining, mineral soil

Vegetation: Trees and bushes. Swamps are classified according to the vegetation, like coniferous swamp, hardwood swamp, shrub swamp etc

Marsh: Wetlands mostly inundated with water leading to waterlogged soil  

Soil: Organic and mineral soil

Vegetation: Hydrophytic plants adapted to waterlogged soil

Estuaries: Wetland regions enclosed by land one side where fresh water mixes with saline ocean water.  

Soil: Saline alkaline soil

Vegetation: Mangrove trees

Rivers and lakes are water bodies that form a part of wetlands.  

Rivers are flowing water bodies which flows through water current and picks up sediments as it flows.

Lakes are stationary water bodies that are enclosed by land mass on all its sides.

The wetlands act as a natural filter and receive all the sediments, pollutants etc which are dissolved in water and carried by the rivers and other water sources.

4 0
3 years ago
Read 2 more answers
Macromolecules and Carbohydrates
zvonat [6]

Answer:

Explanation:The large molecules necessary for life that are built from smaller organic molecules are called biological macromolecules. There are four major classes of biological macromolecules (carbohydrates, lipids, proteins, and nucleic acids), and each is an important component of the cell and performs a wide array of functions. Combined, these molecules make up the majority of a cell’s mass. Biological macromolecules are organic, meaning that they contain carbon. In addition, they may contain hydrogen, oxygen, nitrogen, phosphorus, sulfur, and additional minor elements.

Carbon

It is often said that life is “carbon-based.” This means that carbon atoms, bonded to other carbon atoms or other elements, form the fundamental components of many, if not most, of the molecules found uniquely in living things. Other elements play important roles in biological molecules, but carbon certainly qualifies as the “foundation” element for molecules in living things. It is the bonding properties of carbon atoms that are responsible for its important role

7 0
3 years ago
Other questions:
  • Diarthrosis joints are subclassified according to the kind of movement that they permit. Which types of diarthrosis joints allow
    9·2 answers
  • the substance that are before any chemical reaction are called 1) dioxides 2) oxygen 3) products 4) reactants
    13·1 answer
  • Unwrapped food placed in a freezer experiences dehydra- tion, known as “freezer burn.” why?
    5·1 answer
  • The muscles of the digestive tract are called smooth cardiac muscles? true or false
    7·1 answer
  • There is a limit to the amount of carbon dioxide that can be processed my plants<br> true <br> false
    8·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What are the genotype for each person ?
    12·1 answer
  • In the water cycle in the form of rain or snow falls from the clouds
    10·2 answers
  • The difference between plant and animal cells is:
    10·1 answer
  • Eukaryotic cells produce new cells for growth and repair through a cell division process known as.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!