1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
3 years ago
11

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g.

Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Biology
1 answer:
jek_recluse [69]3 years ago
3 0

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

You might be interested in
PLEASE HELP EMERGENCY!! IF YOU ARE NOT 100% SURE ABOUT YOUR ANSWER DO NOT ANSWER THEN!! PLEASE!!
marysya [2.9K]

Answer:

Lung disease is any problem in the lungs that prevents the lungs from working properly. There are three main types of lung disease:

Airway diseases -- These diseases affect the tubes (airways) that carry oxygen and other gases into and out of the lungs. They usually cause a narrowing or blockage of the airways. Airway diseases include asthma, COPD and bronchiectasis. People with airway diseases often say they feel as if they're "trying to breathe out through a straw."

Lung tissue diseases -- These diseases affect the structure of the lung tissue. Scarring or inflammation of the tissue makes the lungs unable to expand fully (restrictive lung disease). This makes it hard for the lungs to take in oxygen and release carbon dioxide. People with this type of lung disorder often say they feel as if they are "wearing a too-tight sweater or vest." As a result, they can't breathe deeply. Pulmonary fibrosis and sarcoidosis are examples of lung tissue disease.

Lung circulation diseases -- These diseases affect the blood vessels in the lungs. They are caused by clotting, scarring, or inflammation of the blood vessels. They affect the ability of the lungs to take up oxygen and release carbon dioxide. These diseases may also affect heart function. An example of a lung circulation disease is pulmonary hypertension. People with these conditions often feel very short of breath when they exert themselves.

Explanation:

Put it your own words cause this is kinda advance for 7th

5 0
2 years ago
Read 2 more answers
Name some organs that the diaphragm pushes against during inspiration
ahrayia [7]
Upon inhalation, the diaphragm contracts and flattens and the chest cavity enlarges. This contraction creates a vacuum, which pulls air into the lungs.
5 0
3 years ago
Which do you think has a higher caloric value per serving, fats or carbohydrates (sugars and starch)?
murzikaleks [220]
I would believe that sugars and starches would have the most caloric value.
3 0
3 years ago
Identify the environmental factor that is formed by an attractive environment.
Dmitriy789 [7]
<span>There are five environmental factors are used to create an attractive environment is, competitors, threat of entry, substitutes, suppliers, customers. These are the main factors that help to determine how attractive or unattractive an environment.</span>
7 0
3 years ago
What organ and system protects by forming a selective barrier?
Radda [10]

Skin and Integumentary system protects by forming a selective barrier.  

<u>Explanation</u>:

Multicellular organisms unlike unicellular organism have a variety of systems each having a different function. The body of multicellular organisms is covered with epidermis or skin which is known as  largest organ of the body. The skin consists of many sensory receptors and protects by enclosing muscles and other body tissues. While Integumentary system is made with skin and its various appendages like hair, feathers, nails etc. with receptors and secretary pores and protects the body from pain.

6 0
3 years ago
Other questions:
  • Help please will upvote brainly! Use logic to decide the order. Which process has happen first? Drag the box to its correct posi
    10·1 answer
  • 14. Which of the following statements about earthquakes is false? A. The building and release of stress along a plate boundary c
    14·2 answers
  • Why is adult stem cell research less controversial than embryonic stem cell research?
    8·2 answers
  • Cell differentiation always involves
    9·1 answer
  • Anyone know #1? Thanks!
    15·1 answer
  • Why is there such thing as life???
    10·1 answer
  • The development of a seed into a new plant is also called ______________ (pollination/germination).
    13·2 answers
  • Kelp ________. is eaten by sea otters is eaten by orcas suffers intense herbivory from zebra mussels suffers intense herbivory f
    5·1 answer
  • why do you think that HIV infection usually fails to promote a strong immune response to contact the disease​
    11·2 answers
  • Item
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!