1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
3 years ago
11

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g.

Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Biology
1 answer:
jek_recluse [69]3 years ago
3 0

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

You might be interested in
What are enzymes, and why are they important to living things?
adell [148]

Answer:

They speed up chemical reactions. Without them you wouldn't be alive. They break down macromolecules, and also lower the amount of energy needed for a chemical reaction to happen.

3 0
3 years ago
Name three arthropod head appendages and their functions
denis-greek [22]
<em>Structure and Function of ArthropodsArthropods range in length from about 1 millimeter to 4 meters (about 13 feet). They have a segmented body with a hard exoskeleton. They also have jointed appendages. The body segments are the head, thorax, and abdomen. </em><span><em> In some arthropods, the head and thorax are joined together as a cephalothorax.</em></span>
6 0
3 years ago
BIOLOGY-STARS-THANKS-BRAINIEST
vova2212 [387]

D. POPS.

Your answer is D because pesticides have aldrin, chlordane, .... which are all POPS.

3 0
3 years ago
Which of the following is necessary for the light-independent reactions to proceed?
Yanka [14]

Answer;

C) ATP

Explanation;

-Photosynthesis can be divided into two parts: the light-dependent reactions and the light-independent reactions (also referred to as the "dark" reactions).

-The two products of the light-dependent reactions of photosystem are ATP and NADPH.  The movement of high energy electrons releases the free energy that is needed to produce these molecules.  The ATP and NADPH are used in the light-independent reactions to make sugar.

-The light-independent reactions, or dark reactions, of photosynthesis are chemical reactions that convert carbon dioxide and other compounds into glucose. These reactions occur in the stroma, the fluid-filled area of a chloroplast outside the thylakoid membranes.

8 0
3 years ago
What is the unknown mineral most likely that has a density of 7.14
Gelneren [198K]
The answer would be iron
5 0
3 years ago
Other questions:
  • As a cell grows, the ________________ decreases and the cell must divide or die.
    9·2 answers
  • Pleaaseee heeelp <br>explain the origin of the universe precedes the origin of life
    11·2 answers
  • A therapist at a free university clinic treats elementary school children with behavior problems who are referred by a social se
    9·1 answer
  • Anthony draws 2 mL of a water sample into a glass pipet. If he wants to culture the growth of microorganisms in the water, what
    7·2 answers
  • Why would competition be considered a limiting factor within a ecosystem
    9·1 answer
  • What are the possible effects of a formal system entering an area?
    8·1 answer
  • If the organisms at level 2 were to decrease, explain what would happen to 6 points
    15·1 answer
  • Cell membrane and movement across the Membrane.
    6·1 answer
  • Question 6
    15·1 answer
  • Soil is a combination of tiny rock fragments and decayed plant materials how do u think soil helps a plant
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!