1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
3 years ago
11

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g.

Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Biology
1 answer:
jek_recluse [69]3 years ago
3 0

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

You might be interested in
List the five classes of antibody heavy chains and provide one function for each.
Lesechka [4]

Answer:

IgM, IgA, IgE, IgD and IgG

Explanation:

IgM functions in the initial response to offence.

IgA is important for protection of mucus membranes such as in saliva, sweat, tears and gastric fluid.

IgE is active during allergic reactions and defense against infections.

IgD is found on the surface of lymphocytes and is activated upon contact with antigens.

IgG forms part of the secondary response to antigen and is also responsible for newborn protection.

8 0
3 years ago
WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!
umka21 [38]
I’m definitely gonna say the first choice. The others don’t make much sense
4 0
3 years ago
Read 2 more answers
Which of the following is an example of point-source pollution?
kodGreya [7K]

Answer: D. Acid from abandoned mines

Explanation:

Point source pollution can be define as the pollution that can be caused by a pollutant whose source of origin is known. As the source of origin is known the path of the pollutant can be traced back to it's origin hence, the pollution can be controlled.

Among the options given, D. Acid from abandoned mines. is the correct option this is because of the fact that the source of origin of the pollutant is known that is abandoned mines.

6 0
3 years ago
Read 2 more answers
Which of the following statements about the compound HCI is true?
sukhopar [10]
Answer.
The answers is A; The physical and chemical properties of HCl are different from those of H2 and Cl2.

Explanation; 
Hydrogen chloride is a gas, which is a molecule made up of a hydrogen and a chlorine atom bonded by a single bond. 
The chemical and physical properties of HCl differs from those of hydrogen and chlorine. For example; they have different molecular weight; HCl is colorless, while chlorine is greenish yellow and hydrogen is colorless
8 0
2 years ago
Read 2 more answers
Match each fossil with the layer where it’ll be present based on these conditions: Dinosaurs existed before birds. Corals existe
Talja [164]

a - Birds

b - Dinosaurs

c - amphibians

d - corals

e - trilobites

8 0
2 years ago
Read 2 more answers
Other questions:
  • What is one way to classify mud found in an ecosystem
    9·2 answers
  • What is a societal problem that science can best help solve​
    5·2 answers
  • Ovules are found within structure _____. A flower contains definite structures labeled from A to E. Letter A marks structures si
    12·1 answer
  • 1. Living in herd is an ______adaptation?
    8·2 answers
  • What is a source of large molecules that are needed for life? (4 letter word ONLY)
    15·1 answer
  • You are told that 20% of a population is homzygous recessive. What variable is that referring to in the Hardy Weinberg equations
    15·1 answer
  • 9 and 10! Brainliest involved
    9·1 answer
  • Can someone please help me with this I’ll give u brain list just please !
    11·1 answer
  • Pls help ASAP WILL GIVE BRAINLIEST 100POINTS!
    8·1 answer
  • sustainability can be excercised in the harvesting of many different natural resources describe how t
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!