1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
3 years ago
11

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g.

Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Biology
1 answer:
jek_recluse [69]3 years ago
3 0

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

You might be interested in
What are two ways in which photosynthesis is important ?
pantera1 [17]
Photosynthesis is a very important thing in nature that affects everyone. It is important because it provides oxygen which is something we must have to be able to survive. Another reason it is important is because photosynthesis is the ultimate source of energy for all the food that humans require and all is the source of energy for some of the supplies we use in life.
4 0
4 years ago
Read 2 more answers
Area A receives more than ten inches of rain per year. Area B receives less than one inch of rain per year. Which of the followi
Brrunno [24]

Answer:

D

Explanation:

8 0
3 years ago
Unlike the somatic nervous system, the autonomic nervous system A. regulates voluntary activities. B. is part of the motor divis
konstantin123 [22]

Answer: C consists of a sympathetic and parasympathetic nervous system


With the Autonomic  Nervous System (ANS) the bodily actions are done without thinking or being controlled, which occurs with the internal organs such as the heart beating, digestion, sexual arousal, and other functions that can't be controlled.


Hopefully this helped and good luck!!!

7 0
3 years ago
Read 2 more answers
How does nitrification occur in nature, starting from gaseous Nitrogen?​
Alecsey [184]
Nitrification. The conversion of ammonium to nitrate is performed primarily by soil-living bacteria and other nitrifying bacteria. In the primary stage of nitrification, the oxidation of ammonium ( NH+4) is performed by bacteria such as the Nitrosomonas species, which converts ammonia to nitrites ( NO−2).
4 0
2 years ago
Read 2 more answers
Please help with biology ASAP
Mariana [72]
Hey there!

Option 1 would be correct. Allopatric Speciation occurs when new species arise, resulting from the result of geographic isolation. 

I do hope this helps. ~Alexa
8 0
3 years ago
Other questions:
  • When can exponential growth occur in a population?
    10·1 answer
  • The wind stirs up _<br> currents.
    13·2 answers
  • Adults with more than a twelve (12)-month history of migraines were assigned randomly in a double-blinded study to receive treat
    7·1 answer
  • Select the phrase that best describes po2 at the arterial ends of the pulmonary capillaries. the po2 is higher at first in the c
    8·2 answers
  • Functions of transportation system in our body
    9·1 answer
  • PLEASE ANSWER THIS!! <br>PLEASE!
    5·2 answers
  • Zero elevation is also known as<br>A. peak<br>B.profile<br>C.sea level <br>D.base​
    11·1 answer
  • 1. How long does it take for the Moon to<br> complete one rotation?
    7·2 answers
  • Which two factors could lead to the evolution of a species over time?
    6·1 answer
  • Which of the following matches a human action with its impact?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!