Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g.
Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
- Protein sequence:Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*
- DNA 5' UTR: ATTTTAGCC
- RNA 3' UTR: UAAAAAUAAAAU
Explanation:
Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.
<span>George Simmel was a pioneer in sociological studies due to the fact that he developed the concept of the sociological imagination, and believed that societies can be understood through an empirical scientific approach known as positivism which is still used in research today.</span>
Crossing over – often, the sister homologous chromosomes of a cell exchange genetic material through recombination of genes.
Independent assortment/random fertilization – there are numerous variety of ways that the chromosomes of the gametes can combine, after meiosis, through fertilization to form a zygote
Mutation – on rare occasion, there is a slight and random change in the genes of a gametic cell caused by environmental factors.
