1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
3 years ago
11

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g.

Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Biology
1 answer:
jek_recluse [69]3 years ago
3 0

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

You might be interested in
A biological cycle, or rhythm, that is approximately 24 hours long is called a(n) ________ cycle
tankabanditka [31]

A biological cycle, or rhythm, that is approximately 24 hours long is called a circadian cycle

5 0
3 years ago
DNa is genetic material describe​
9966 [12]

Answer:

Yes, DNA is a genetic material because it is passed down through the genes of your parents on to you which creates the traits that make you unique.

Explanation:

6 0
4 years ago
Read 2 more answers
What are some services give me like 5 .
vaieri [72.5K]

Answer:flower arranger

Explanation:

7 0
3 years ago
Read 2 more answers
Finish the sentence
Firlakuza [10]

Answer: few animals can undergo both.

3 0
2 years ago
When acetyl-CoA is fed into the TCA cycle, it eventually forms carbon dioxide. The energy released from this oxidation is conser
Kay [80]

Answer:

The correct answer is:

a)FADH2

c)GTP

e)NADH

Explanation:

The Citric acid cycle(TCA) also known as the <em>Kreb cycle,</em> is a focal metabolic center of the cell. It is a sequence of chemical reactions in which the acetyl portion of acetyl CoA is degraded to carbon dioxide and hydrogen atoms.These reactions all occur in the matrix of the mitochondria. This cycle is also an important source of precursor for other molecules such as amino acids, nucleotide bases cholesterol etc. The function of the citric acid cycle is the gathering of high-vitality electrons from carbon fuels. The citric acid cycle removes electrons from acetyl CoA and use it to reduce NAD and FAD into NADH2 and FADH2 respectively.

<em>Overall, The citric acid cycle oxidizes two carbon units(from acetyl CoA) and produces two molecules of carbon dioxide, one molecule of GTP and high energy electrons which are present in the form of NADH2 and FADH2</em>

4 0
3 years ago
Other questions:
  • QUESTION 1<br> You want to start a Word document. Which of the following is the BEST first step?
    6·1 answer
  • In most ecosystems, the original source of energy for the living things in the system is __________.
    5·2 answers
  • When would an oblique cut be most appropriate?
    8·2 answers
  • PLEASE HURRY 10 PTS AND BRAINLIEST IF RIGHT
    14·2 answers
  • Which characteristic of DNA makes labeling it with radioactive 32P possible?
    7·1 answer
  • I honestly dont know why my teachers think im supposed to know this stuff smh
    10·2 answers
  • How does energy from a top level consumer get recycled back into the pyramid?
    7·1 answer
  • What is the correct order of photosynthesis?​
    8·1 answer
  • In treating victims of carbon monoxide poisoning, artificial respiration is first applied in the open air, followed by the admin
    14·1 answer
  • Please help me I don’t ‘now how to write essays very well high school level I desperately need help on this one assignment
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!