1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
3 years ago
11

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g.

Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Biology
1 answer:
jek_recluse [69]3 years ago
3 0

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

You might be interested in
Your heart functions in your body as a(n)
Bess [88]
The most appropriate answer is D !!
8 0
3 years ago
If a researcher electrically stimulates the _____ in an animal, the animal will immediately wake up and be alert.
jeka94
If a researcher electrically stimulates the reticular formation in an animal, the animal will immediately wake up and be alert. Its purpose is to have some control of sensory signals and thus has the ability to alert the body when it is tired or needs to be awake.
6 0
3 years ago
Which measures the mass of an object
Makovka662 [10]

Mass is measured by using a balance comparing a known amount of matter to an unknown amount of matter. Weight is measured on a scale.

8 0
3 years ago
What are the two types of density change?
Anton [14]
One type of density change is mass over volume.
4 0
3 years ago
Read 2 more answers
What is the partially shaded outer region of shadow cast by the earth or moon called?
Neporo4naja [7]

Answer:

Penumbra I believe

8 0
2 years ago
Read 2 more answers
Other questions:
  • How many species of insects are there as of 2017?
    8·2 answers
  • A river separates two groups of mice, one black and the other all white. a beaver dam allows the mice to cross the river. over t
    15·2 answers
  • The law of ___ b elps explain why the density of air as the altitude above earth's surface increases
    7·2 answers
  • In most primate species, males rarely participate in infant care. <br> a. True <br> b. False
    11·2 answers
  • Which of the following does not lay amniotic eggs?
    8·1 answer
  • What is a tRNA isoacceptor?
    5·1 answer
  • What happens to a cell during the process of differentiation?
    5·1 answer
  • What refers to any instrument or weapon used in a death, such as a knife or firearm?
    11·1 answer
  • What is the result of translation?
    8·1 answer
  • ASAP! ILL MARK BRAINLIEST
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!