1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
3 years ago
11

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g.

Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Biology
1 answer:
jek_recluse [69]3 years ago
3 0

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

You might be interested in
Enzymes and acidic juices in the stomach, which breaks proteins down into smaller molecules, is known as
djyliett [7]

The answer is; Pepsin


Pepsin is first secreted by the chief cells of the stomach wall and the inactive precursor called pepsinogen. When pepsinogen interacts with the acidic environment of the stomach due to hydrochloric acid, it is turned to pepsin. The pepsin breaks down large protein molecules to smaller molecules.


6 0
3 years ago
Irradiated food may be dangerous because it contains low levels of radioactive compounds.
USPshnik [31]

Answer: False

Explanation:

Food irradiation is a process in which the food is exposed to the treatment of radiations. This helps in increasing shelf life and decreasing the colonization of the pathogens on the food. This process does not make the food radioactive.

5 0
3 years ago
The chemical equation shown represents photosynthesis.
ladessa [460]

Answer: The role of substance A in photosynthesis is: it combines with water to form glucose.

Explanation:

4 0
2 years ago
In some plants, flower color, or __________ of the plant, is dependent upon environmental factors such as the acidity of soil. A
olga2289 [7]
The answer would be d) phenotype. The phenotype is the physical characteristic while the genotype is the combination of alleles from the parent--basically the part that you can't really see. The color of a flower is prominent, so that would be its phenotype. An organism's phenotype can also include certain behavioral characteristics as well, not just the way it looks! Hope this helped :)
5 0
3 years ago
Making a water cycle model
neonofarm [45]

Answer:

C. When the ice melts, it will model infiltration as it absorbs into the soil.

I got it right on USATESTPREP.

3 0
3 years ago
Other questions:
  • In mice, brown eyes (B) are dominant over blue (b). A homozygous brown-eyed male mouse mates with a blue-eyed female and they ha
    6·1 answer
  • A string of islands formed by the volcanoes along a deep-ocean trench.
    9·2 answers
  • What words are missing from the diagram
    14·2 answers
  • Which of these BEST describes our current understanding about how species evolve over time?
    11·1 answer
  • How did the skeleton change during bird evolution?​
    9·1 answer
  • State what is meant by the term metabolic.
    15·1 answer
  • BRAINLIEST - ANSWER QUICKLY
    7·2 answers
  • Why are both carbohydrates and lipids important in animal cells?
    15·2 answers
  • The highlighted region is the highest visual acuity because it contains the highest concentration of ________.
    14·1 answer
  • Passage of peptides through the blood-brain barrier with colloidal polymer particles (nanoparticles). Brain Res 1995, 674 (1), 1
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!