1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
3 years ago
11

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g.

Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
Biology
1 answer:
jek_recluse [69]3 years ago
3 0

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

You might be interested in
I need help with this
Gekata [30.6K]
What do u need help with?
7 0
3 years ago
Someone plz help with question one. i’ll give brainless
Scrat [10]
I think it’s A
Hopefully this helps!!
8 0
3 years ago
A 50-year-old male presents with hypotension, hypoxemia, and tracheal deviation to the left. tests reveal that the air pressure
Aneli [31]
<span>In this case, the nurse would believe that the patient was experiencing Tension pneumothorax. Tension pneumothorax is the build up of air over time in a pleura space. It is generally caused by a laceration in the lung which lets air pass into the pleura space but then get stuck there. It presents a pressure which makes ventilation difficult, it cause the same effects as a one way valve.</span>
5 0
3 years ago
in the cross between two black guinea pigs shown in Punnett square a what is the probability that will be black
Brilliant_brown [7]
The probability of the guine pigs blend black is 2-3
4 0
3 years ago
URGENT!!!!!! PLZ HELP!!!!!!
Viefleur [7K]
It’s literally a spider
6 0
2 years ago
Other questions:
  • The level of organization when different primary tissues are combined together and work together to perform a common function is
    8·1 answer
  • In Dr. Losos’s experiment, why was it important that the experimental islands lacked lizards?
    9·1 answer
  • Which unit is used to measure mass in the metric system?
    9·2 answers
  • What is fossils used for?
    11·2 answers
  • Which of the following scenarios illustrates a product of direct use?​
    15·1 answer
  • Imagine you have three test tubes containing identical solutions of purified, double-stranded human DNA. You expose the DNA in t
    14·1 answer
  • Trypanosoma most resembles which of the unicellular algae?
    15·1 answer
  • A single hydra can produce offspring by growing a new individual from any portion of its body. What is the reproduction method o
    11·2 answers
  • Need help
    5·1 answer
  • after the 1988 fires, scientists made careful observations of the changes on the yellowstone plateau. the data they collected is
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!