1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
just olya [345]
3 years ago
11

The meanings of health and illness are dependent on historical, cultural, and situational contexts. Stigma may be attached to ce

rtain disease states and to those who suffer from them.
True / False.
Biology
1 answer:
Yuri [45]3 years ago
5 0

Answer:

The answer is true.

Explanation:

The meaning of health and illnes was always dependent on historical and cultural contexts throughout human history. This was the case especially for psychological illnesses and certain diseases that alter the physical appearence of people. Even in today's world where science is so advanced and the world is interconnected through an immense web of communication, these stigmas for mental illnesses and bloodborne diseases, especially for HIV and alike, continue to exist in parts of the world.

I hope this answer helps.

You might be interested in
Which activity would reduce the biodiversity in a forest ecosystem
bearhunter [10]
If animals are only reproducing with each other so they will most likely get the same traits or very similar traits
5 0
3 years ago
The Earth's core is
lisov135 [29]
The earths core is D.hotter than both the crust and mantle
7 0
4 years ago
When male langurs take over another male's group, they sometimes kill all the young infants. what is the evolutionary explanatio
babymother [125]
Orange
 is the answer orange


8 0
4 years ago
From the time a baby is born, what is she or he eager to do?
marusya05 [52]

Answer:

D. Play with her parents, primary caregivers, and toys

4 0
3 years ago
If a rat population that lives in a cold northern tundra climate was moved to the desert, where temperatures are much warmer, an
anygoal [31]

Answer:

d. A smaller body size

Explanation:

The smaller a body size is the larger the body surface area is. Larger body surface area would allow for increase in lost of more excess heat to the environment.

Therefore, hypothetically, one of the obvious adaptation that would be evolved by the rat population that was moved from their previous cold northern tundra climate to a desert environment is a smaller body size. This would enable them in cooling off and preventing over-heating.

4 0
3 years ago
Other questions:
  • As blood enters the ____________ , the walls of these vessels expand and contract, which can be felt as the pulse where the ____
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following experiments would help him collect the best data
    14·1 answer
  • Which statement best describes the role of DNA
    8·1 answer
  • Unattached microbes are moved from the lungs to the epiglottis by the _______ effect.
    7·1 answer
  • Explain which cells tissues or organs should be modified to lead to successful photosynthesis in animals or human Discuss how th
    8·1 answer
  • List the cups in order of the most hatched eggs to the least
    9·1 answer
  • How many strands of mRNA are transcribed from the two “unzipped” strands of DNA?
    5·1 answer
  • Take points guys.....​
    9·2 answers
  • What is photosynthesis ??????​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!