1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paladinen [302]
3 years ago
11

Prokaryotic and eukaryotic cells have many differences, but they also share some common features. Which of the following may be

found in either type of cell? A. mitochondria B. cell walls C. Golgi bodies D. nuclei
Biology
1 answer:
AysviL [449]3 years ago
5 0

Answer: The answer is option B. Cell Walls

Explanation: Prokaryotic cells are much smaller than eukaryotic cells, have no nucleus, and lack organelles. All prokaryotic cells are encased by a cell wall. In eukaryotes, vertebrates don't have a cell wall but plants do.

You might be interested in
Which of the following correctly describes the function of chloroplasts?
Mrrafil [7]

Explanation:

A.chloroplast has chlorophyll trapping sunlight used to build.....

5 0
3 years ago
What has a person lost function of if they're suffering from carpal tunnel syndrome
Anna11 [10]

Answer:

Hands.

Explanation:

A person with carpal tunnel syndrome has lost function of their hands by definition; one clue is the word "carpal," which in general refers to the hands or structures in the hands, ex) meta-carpals (bones in the hand).

4 0
3 years ago
There are 4 molecules moving across the membrane in this diagram. How many of
Brilliant_brown [7]

Answer:

i think its the first one

Explanation:

8 0
3 years ago
Witch discovery supported the endosymbiotic theory
AveGali [126]
The DNA in mitochondria 
3 0
3 years ago
Which statement describes DNA​
Romashka [77]

Answer:

DNA stores an organism’s genetic code.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the term for an evolutionary change in one species that results in the evolutionary change of another species?
    12·1 answer
  • What Are animals that eat dead animals remains
    7·1 answer
  • About how many brain connections will be present on average for a 3 year old
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Two plants are crossed, resulting in offspring with a 3 dominant:1 recessive phenotypic ratio for a particular trait. This ratio
    9·1 answer
  • A half filled shape represents that the individual is
    5·1 answer
  • What is the genotype of a women who is a carrier heterozygous for color blindness
    15·1 answer
  • What does Black Hawk mean by "coiled themselves among us like the snake"?
    6·2 answers
  • Safety laboratory rules​
    7·2 answers
  • A skeletal muscle's partially contracted state that is normal even when the muscle is not in use is called
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!