1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stellarik [79]
3 years ago
15

What was the first known society?"

Biology
1 answer:
Inga [223]3 years ago
7 0

Answer:

Hunting and Gathering

Explanation:

The first humans were nomads who traveled with their food. This means that they would seasonally move across regions hunting the animals there and gathering plants to eat. These people existed before civilization started. Centuries later, these people would develop agriculture and start society. However, the first people were still hunter-gathers.

You might be interested in
2. What is the goal of the cell cycle/mitosis?
Serjik [45]

Answer:

<em>Mitosis is a process where a single cell divides into two identical daughter cells (cell division). During mitosis one cell? divides once to form two identical cells. The major purpose of mitosis is for growth and to replace worn out cells.</em>

<em></em>

8 0
3 years ago
6.) the process by which large molecules are expelled from a cell
sergiy2304 [10]

Answer:

exocytosis

Exocytosis is the reverse of endocytosis. <em><u>Quatities of material are expelled from the cell without ever passing through the membrane as individual molecules.</u></em> By using the processes of endocytosis and exocytosis, some specialized types of cells move large amounts of bulk material into and out of themselves.

3 0
3 years ago
Read 2 more answers
An example of sustainable resource use is the use of predators and parasites to A. Harm natural resourcesB. Pollinate plantsC. C
Ulleksa [173]

control pest insects

3 0
3 years ago
Explain how bacterial cloning can help increasing the amount of DNA (DNA amplification) and when it is implemented in science or
Nezavi [6.7K]

Answer:

The process of gene cloning involve multiple steps. It involves many enzymes, bacterial cell, vector to produced an amplified number of cell and hence product.

The gene of interest is find and then it is carried into the bacterial cell by the help of vector.

The vector is then carried to get incorporated into the bacterial cell. In this way the bacterial cell starts replicating and the and the desired product is produced in high amount.

4 0
3 years ago
A researcher infects a bacterium with a bacteriophage and notices that the infection does not immediately bring about the destru
mamaluj [8]

Answer:

Answer is lysogenic cycle.

Explanation:

Lysogenic cycle is a situation where a virus replicate its DNA using a host cell. And it involves the following stages, attachment, penetration, uncoating, biosynthesis, maturation and release.

This cycle is one of the two viral reproductive cycles, the other is lytic cycle.

3 0
3 years ago
Other questions:
  • Which question can be answered using the scientific process?
    9·1 answer
  • Which event is most likely to keep happening if deforestation continues on earth?
    11·1 answer
  • How are these four types of protists similar to animals? how are they different?
    6·1 answer
  • High-altitude, high-velocity "rivers" of air are called
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • This device can be used to remove most biological agents that enter a house.
    9·1 answer
  • How do the number of chromosomes in cells that go through meiosis and mitosis compare?
    11·1 answer
  • At the beginning of cellular respiration ____________________________ occurs, where glucose is broken down into pyruvate and ATP
    11·1 answer
  • What's true about all three of the first babies?
    9·2 answers
  • What is natural selection and what are ifs effects on allele frequencies
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!