Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The food sources available for a particular species in an ecosystem. Also space where they can live and reproduce, but food is the main factor.
Answer:
The correct answer is - Transcribing information in the DNA sequence for use by the cell.
Explanation:
The transcription process is the process that involves copying the sequence of DNA, that sequence is the information or code for the particular protein, to make RNA molecule that brings the information to the ribosome where translation process initiated to produce amino acid chain.
In the given diagram, the cellular process is showing is transcription as there is transcribing the sequence is shown which copy the sequence that is used for the cell and a useful part of protein synthesis
A gene in an egg cell inserts two extra base pairs!!