1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Orlov [11]
3 years ago
8

What name is given to elements with the same number of protons but differing numbers of neutrons?

Biology
2 answers:
Tom [10]3 years ago
7 0
Three hydrogen atoms have the same number of protons<span>, </span>but<span> a </span>different number<span> of </span>neutrons<span>. These atoms are called isotopes, which are atoms of the </span>same element<span> that have a </span>different number<span> of </span>neutrons<span>. I hope this answer helps you. Please mark as Brainiest so I can rank up if it's correct. thanks.♥</span>
Ber [7]3 years ago
7 0

Answer: The name given to elements with the same number of protons but differing numbers of neutrons is<em> </em>Isotope.

Explanation:

When the two different atoms of same element having same number of protons but are differing number of neutrons than those elements are known as isotopes of that element.

For these species, atomic number remains the same but atomic mass differs.

For Example:

_{17}^{35}\textrm{Cl}\text{ and }_{17}^{37}\textrm{Cl} are the two isotopes of chlorine having different masses and same atomic number.

Hence, the correct answer is isotopes.

You might be interested in
True or False: tides only affect the oceans, streams, lakes, and other bodies of water on Earth.
aliina [53]
I think False ..........................................
5 0
3 years ago
Which blood pressure reading is taken when the heart contracts?
butalik [34]

Answer:

systolic

Explanation:

5 0
3 years ago
What happens yo axcess carbohydrates in animals
SVEN [57.7K]

Answer:

Actually, the excess carbohydrates in animal's body is converted into triglyceride

molecules which store them as fat.

So, A is the answer.

5 0
3 years ago
Before 1800, most peppered moths in England were light–colored. During the Industrial Revolution, soot and industrial wastes dar
nata0808 [166]
Natural selection got rid of the light colored moths and helped the darker moths survive and become more abundant.  
8 0
3 years ago
Think about what the DNA looked like.... Relate its chemical structure to how it looks when lots of it is chumped together
Klio2033 [76]

QREWTYRYUYIOUITREWExplanation:

4 0
3 years ago
Other questions:
  • You are a fitness specialist. one of your clients is a long distance cyclist. he complains of bilateral numbness in the little f
    10·1 answer
  • Using a punnett Square and an explanation described if I square-eyed pet mates with another square-eye pet, can they have any ro
    10·1 answer
  • When liquid water is heated by the Sun, it often evaporates, becoming a gas and entering the atmosphere. When gaseous water is c
    10·2 answers
  • What are earthquakes
    10·2 answers
  • How do we combine forces?
    14·1 answer
  • 12000 m = ___ km <br> 0.33 L = ____cl
    7·1 answer
  • A gene mutation changes a section of DNA whereas a Chromosome mutation changes a base.
    7·1 answer
  • Chromosomes are made up of (a) DNA (b) Protein (c) DNA and protein (d) RNA answer fast plzzz
    11·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • What is the condition called where a proximal portion of the stomach pushes through an opening in the diaphragm, allowing stomac
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!