1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
crimeas [40]
3 years ago
9

Why does the earth have different layers?

Biology
1 answer:
Aliun [14]3 years ago
6 0

Answer:

The earth has different layers because as it formed, the lighter parts (like continental crust) floated to the surface, and the really heavy parts (like iron and nickel in the core) sank to the middle. It is just like when you mix oil and water: the oil will float to the surface because it is lighter (or less dense) than the water.

You might be interested in
In stage 1 of photosynthesis, a proton gradient is generated and atp is synthesized. Where do protons become concentrated in the
leva [86]

Answer:

the protons become concentrated in the thylakoid space

7 0
2 years ago
As a cow grazes on grass how much of the grass is energy is transferred to the cow
pantera1 [17]

Answer:10 % I'm pretty sure

Explanation:

3 0
3 years ago
Read 2 more answers
The researchers introduced a small RNA complementary to a portion of the mRNA encoding protein A into the Brec-MUT cells growing
Sonbull [250]

Answer:

Delivered small RNAs can inhibit protein A production through the RNA interference (RNAi) mechanism, and thus impairs angiogenesis  

Explanation:

The pregnancy-associated plasma protein-A is a protease enzyme involved in the formation of new blood vessels by increasing insulin-like growth factor I (IGF-I) bioavailability. Moreover, small RNAs (<200 nucleotides in length, generally 18 to 30 nucleotides) are non-coding RNA molecules that function in RNA silencing through the RNA interference (RNAi) pathway. Small RNAs are widely used in molecular biology laboratories because they can be delivered into specific cells in order to silence target mRNAs such as, in this case, the mRNA encoding protein A, by complementary base pairing and thereby inducing translational repression. In consequence, mRNAs complementary to delivered small RNAs are silenced through RNAi pathways, i.e., by cleavage of the target mRNA and/or mRNA destabilization.

3 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
The outermost living layer is a plant and animal cell?
blagie [28]

Answer:

epidermis

Explanation:

The epidermis is the protective outer layer of clonally related cells covering all plant organs. and the outer most layer in animals is no

7 0
3 years ago
Read 2 more answers
Other questions:
  • What do you observe happening to the wavelength and frequency of the wave under the spectrum as you slide the green arrow from l
    9·1 answer
  • Explain how the recycling of atp helped save mauro prosperi. why is the ability to recycle this molecule an advantage? based on
    12·1 answer
  • in which of yhe following respiratory does gaseous exchange occur? A Alveoli B Trachea v v C Nasal passage D Bronchiole​
    13·1 answer
  • How is meiosis different from mitosis?
    13·2 answers
  • The endosymbiotic theory suggests that a prokaryotic cell ate another prokaryote, giving rise to eukaryotes.
    12·1 answer
  • Explain how genetic modifications impact crop yield. How will this help feed the world in 2050?
    14·1 answer
  • 7 How are divergent boundaries between tectonic plates different from convergent boundaries? А Plates move north at divergent bo
    8·1 answer
  • What does the painting show us about the history of fish in the mediterranean sea?
    6·1 answer
  • Which of the following statements is true?
    12·2 answers
  • Genetic and environmental factors affect which traits are passed on from parent to offspring over generations and how they are p
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!