1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
777dan777 [17]
3 years ago
5

When a cell's DNA has become damaged beyond repair, the cell makes:

Biology
1 answer:
gogolik [260]3 years ago
6 0

Answer:

apoptosis

Explanation:

Explanation: Apoptosis is programmed cell death, and it usually occurs when the DNA of the cell is damaged beyond repair. Photosynthesis and glycolysis are normal metabolic processes of the cell, and would not result from irreversible damage.

You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What structure is the outermost, dense covering around bone?
lesya692 [45]

Answer:

SADSFADVADVADADVADVADVADVADVADVADVADADADSVADVADADSVADVADAVVVVVVVVVVVVVVVVVVVVVVVVVVVV

Explanation:

6 0
2 years ago
g One can measure ATP production from isolated mitochondria in vitro (in a test tube). Changing the pH of the solution that the
Damm [24]

Answer:

This will lead to an  decreases  in the ATPs synthesis. This is because low pH , high acidity favours ATP synthesis, because it increases the  proton concentration for electrochemical gradients needed for energy that  ATPase enzymes makes used of   synthesis  of ATPs.

Therefore a rise in the pH(low acidity) lowers protons levels, and therefore reduced electrochemical gradients , with a drop in energy for ATPs synthesis.

Explanation:

5 0
3 years ago
Blood is best classified as connective tissue because _____.
Oxana [17]
D it is found within all the organs of the body
7 0
3 years ago
Read 2 more answers
Plant cells contain another organelle that functions as a storage tank for excess glucose or starch that is the
Taya2010 [7]
That is the vacuole. They usually fill up with food, water, or other various wastes. 
7 0
3 years ago
Other questions:
  • Which differentiates the key chemical properties of nucleic acids, DNA and RNA? A. Hydrogen bonds B. Functional group C. Hydroca
    8·2 answers
  • What is the formula forfinding your maximum heart rate? (1 point)?
    12·1 answer
  • By which of the following features is Venus characterized?
    10·2 answers
  • BRAINLIESTTT ASAP!!!
    6·1 answer
  • Homeostasis refers to
    6·1 answer
  • 5. Classity Are bears producers or consumers? Explain your reasoning
    10·1 answer
  • A scientist is examining a single-celled organism that is often found in the human body; some examples of this organism are help
    13·2 answers
  • How do you classify a sundew; producer? Consumer? Something else? Explain your thinking.??
    15·1 answer
  • Prior to the work of mendel, inheritance was viewed as resulting from ______
    15·1 answer
  • What enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the ends of linear chromosomes
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!