1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
never [62]
3 years ago
13

How does gravity affects the Earth's orbit around the Sun?

Biology
1 answer:
kiruha [24]3 years ago
7 0

Answer:

The Sun's gravitational force is like the tetherball rope, in that it constantly pulls Earth toward it. ... This means that the planet neither flies out into space nor falls into the Sun. Instead, it travels in a nearly circular motion around the Sun, creating an orbit

You might be interested in
Invertebrates with "spine skin" are ______, which would include animals like ______. cnidaria;mollusca;echinodermata;porifera/ s
Nata [24]
Echinodermata; starfish
5 0
3 years ago
Read 2 more answers
With a suitable diagram explain reflex action and reflex arc
iren [92.7K]

Answer:

Reflex action is the sudden uncontrolled reaction towards a certain stimuli eg response to hot iron

Reflex arc is the path taken by reflex action to a certain stimuli

Diagram depends to

Receptor(eg skin), receptor nerve(sensory neurone),centre reflex arc(spinal cord most of reflex action) they met relay neurone, motor neurone and ends at reflexor (eg muscle)

7 0
3 years ago
During fmri scans of individuals with ocd, researchers have found specific brain areas showing elevated activity while the perso
Katarina [22]
The brain region identified lighting up during an fMRI scan in a patient with obsessive-compulsive disorder is the anterior cingulate cortex. The anterior cingulate cortex is part of the limbic system and is responsible for the emotion formation, memory, processing, compulsions and obsessions, and others.
6 0
3 years ago
Imagine you are an astronomer who recently discovered a star with a system of planets. What
irina1246 [14]

The planets closest to the star are rocky planets formed by elements with high melting points. Moreover, planets far away are gaseous planets and they are composed of elements with lower melting points.

<h3>Rocky planets and gaseous planets</h3>

The rocky planets consist of silicate rocks and/or metals, whereas gaseous planets are mainly composed of hydrogen and helium.

The rocky planets of the solar system include planets closest to the sun, i.e., Mercury, Venus, the Earth, and Mars.

The gaseous planets of the solar system include faraway planets, i.e., Jupiter, Saturn, Uranus, and Neptune.

Learn more about rocky planets here:

brainly.com/question/17428928

3 0
3 years ago
What is true of matter in ecosystems?
Sidana [21]
D.Elements continuously cycle between the physical environment and living organisms.

Ecosystem is encompassing all the life on earth in the physical environment that supports it. An ecosystem involves both the biological (plants, animals, human beings) and non-biological (land, water, soil, and atmosphere) community which interacts as a system. More importantly, the living things are very dependent on the abiotic community since it cannot survive by itself. Every animal, plant and human needs the primary physiological needs of water, food and shelter provided by the abiotic system.  <span> </span>

4 0
3 years ago
Other questions:
  • Autonomic centers in the ________ exert neural control over hormone secretion by the adrenal medullae. a) pineal gland b) pituit
    6·1 answer
  • What effect does inbreeding have on a population?
    10·1 answer
  • Thoracic vertebrae differ from the other vertebrae in that they have ________.
    9·1 answer
  • Which of these ingredients is important in making plastics? carbon dioxide particulate matter natural gas plant liquids volatile
    14·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Put the protein digestion steps in order of their occurrence during the digestive process.
    6·2 answers
  • The ________________ is a passageway for both air and food to travel. MULTIPLE CHOICE.
    6·1 answer
  • How long do footprints last on the moon?
    8·1 answer
  • The genotype dd is considered what? (2 words)​
    14·2 answers
  • All viruses rely on<br> friends<br><br> themselves<br><br> a host<br><br> the weather
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!