1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Minchanka [31]
3 years ago
13

What part of the project plan that tells another person about what you are doing?

Biology
2 answers:
Jlenok [28]3 years ago
4 0
B) Objectives
This is because they get a better idea of your project based on your goals.
irga5000 [103]3 years ago
3 0

B. Objectives project.

<h2>#Continuar aprendiendo</h2>
You might be interested in
If you shine a bright light directly in a person's eye, the pupil of the eye will reflexively constrict. using pavlov's terminol
romanna [79]

I think that the bright light would be the "stimulus" and the pupil constricting would be the "response".

8 0
4 years ago
The basement membrane consists of __________ secreted by __________.
katen-ka-za [31]
<span>Proteins secreted by epithelial cells. The basement membrane forms as a thin protein fibre membrane with mucopolysaccharides. It separates an epithelium from underlying tissue. Its main function is to anchor epithelium to dermis underneath. The membrane consists of different extracellular matrix structural proteins.</span>
4 0
3 years ago
Backup of sewage in the prep area and a serious pest infestation are hazards that
Burka [1]
The backup of sewage in the preparation area and serious pest infestations are hazards that requires closure. In which should be important to have considering their harmful substance and causes, some also include significant lack of refrigeration and lack of interruption of electrical or water service.
6 0
3 years ago
What process allows cells to make copies of themselves
AlekseyPX
Mitosis allows cells to make copies of themselves
4 0
3 years ago
Which of the following is a source of genetic variation in sexually reproducing organisms?
kap26 [50]
The answer is d.meiosis

4 0
4 years ago
Other questions:
  • PLEASE ANSWER!!!! Which organ in human body absorbs water?
    8·1 answer
  • The cell cycle is regulated at the molecular level by a set of proteins known as:
    10·2 answers
  • A/an ______ is the result of medical treatment that yields the exact opposite of normally expected results.
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which phrase best describes DNA? A. the structure that allows biochemical reactions to occur B. the structure that translates in
    7·1 answer
  • An example of effectors' roles in homeostatic responses is observable when an example of effectors' roles in homeostatic respons
    7·1 answer
  • Which gas is transported by the circulatory system in humans and is used by cells during respiration to release energy stored in
    15·1 answer
  • Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
    6·1 answer
  • How is a primary succession different from secondary succession?​
    7·1 answer
  • Which process of cellular respiration generates the most ATP when glucose is completely oxidized to carbon dioxide and water?.
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!