1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lbvjy [14]
3 years ago
5

Need help ASAP! THANK YOU BOYS AND GIRLS

Biology
1 answer:
Maru [420]3 years ago
3 0

Answer:

The answer is A.

Explanation:

Found it on cancer.gov

Cancerous tumors are malignant, which means they can spread into, or invade, nearby tissues. In addition, as these tumors grow, some cancer cells can break off and travel to distant places in the body through the blood or the lymph system and form new tumors far from the original tumor

You might be interested in
Each isotope has a special name derived from Latin (protium, deuterium, and tritium). What structural feature do these names ref
Eduardwww [97]

An isotope of any element is the same, with a variation in the neutrons of the nucleus.

The mass number change but the atomic number doesn't.

In this case, protium, deuterium, and tritium are all hydrogen isotopes.

Protium is 1H or Hydrogen-1 is without neutrons.

Deuterium is 2H  or Hydrogen-2 has one neutron.

Tritium is 3H or Hydrogen-3 has two neutrons.

8 0
4 years ago
El término virulencia hace referencia a:
garik1379 [7]
B la patogenicidad de un virus
8 0
3 years ago
Why do ribosomes attach to the endoplasmic reticulum
matrenka [14]
The ribosomes that is synthesizing the protein is directly attached to the ER membrane
6 0
3 years ago
Dr. Han is studying which brain structure is associated with aggressive behavior among rats. Which part of the brain is she like
djyliett [7]

Answer:

The correct answer is - The amygdala

Explanation:

The amygdala is the part of the brain that is found in the medial temporal lobe of the brain. It is an almond-shaped structure of neurons. The amygdala is an essential region of the brain that has a major role in processing emotions such as aggression and others. It is the region of the limbic system that presents both sides of the brain.

Thus, the correct answer is - the amygdala.

7 0
3 years ago
What is the best description of organisms in the precambrian era?
andreev551 [17]
C- Single-celled organisms and soft, boneless animals.
6 0
3 years ago
Read 2 more answers
Other questions:
  • Why is it important that our understanding of social science concepts continue to develop and expand?
    9·1 answer
  • The hurricane center is MOST likely to be near location ___________ on Monday afternoon.
    7·1 answer
  • A few drops of milk are added to a glass of water, producing a cloudy mixture. the water is still cloudy after standing in the r
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What is the relationship between Endomembrane System, Insulin and Insulin Receptor, activation by phosphorylation, membrane-boun
    15·1 answer
  • Which of the following represents a negatively charged ion?<br> OF<br> T<br> 7
    11·1 answer
  • What happens to the density of water when it cools?
    6·2 answers
  • How do the functions of the glycoproteins on the virus and the flagella on the bacteria differ?
    14·1 answer
  • Genes are sections of DNA that code for a particular trait. Genes are:
    9·1 answer
  • Ming and his friends were playing baseball. Ming hit the ball into right field and then ran toward first base. The player in rig
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!