1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solmaris [256]
3 years ago
14

A gene that is hidden is called a

Biology
2 answers:
quester [9]3 years ago
5 0

Protein is the real name for a gene that is hidden


nirvana33 [79]3 years ago
4 0

A recessive gene

Hope this helps you!

You might be interested in
Which are characteristics of scientific questions? Check all that apply.
lisov135 [29]

Answer:

asking about subjective matters, addressing a gap in knowledge, and already having fully confirmed explanations

Explanation:

4 0
3 years ago
Which of the following are the major phagocytic cells in the body?a. T and B lymphcytesb. Eosinophisc. Erythrocytesd. Macrophage
kupik [55]

Answer:

The correct options are MACROPHAGES AND NEUTROPHILSE.

Explanation:

Majority of the white blood cells in humans are specialized phagocytic cells, examples of these are macrophages, neutrophilse, monoctyes, mast cells and dendritic cells. The major functions of phagocytic cells is to protect the human body from disease pathogens. They do this by ingesting foreign bodies that are found in the body.  Macrophages and neutrophilse are the major phagocytic cells in the body, they are the principal effector of non-specific host defense and inflammation.

8 0
3 years ago
Playing video games requires which of the following skills?
gavmur [86]
Problem solving I believe
6 0
3 years ago
Read 2 more answers
Once the DNA of a person has been copied it can be compared to the DNA of other people by using
Furkat [3]
D is the answer to this question hope it helps
4 0
3 years ago
Read 2 more answers
What is the developmental reason that hCG is a good indicator of pregnancy
Zina [86]
Hcg secreted by placenta not the fastest method to detect pregnancy nor it is specific
7 0
3 years ago
Other questions:
  • A company has many genetically engineered poplar trees around its factories. Which best describes the poplar trees?
    14·2 answers
  • What do the grasshopper, toad, and snake have in common? A) They are all producers. B) They are all consumers. C) They are all s
    14·2 answers
  • Cardiac muscle cells are _ like skeletal muscle fibers
    7·1 answer
  • Examine the air pressure map.
    5·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Why do you get less energy from 100 calories of celery than you would from 100 calories of chips?
    14·1 answer
  • Does consuming too much salt cause high blood pressure?
    15·1 answer
  • (50 POINTS)
    7·2 answers
  • Where is cellular respiration involved/what on the picture goes through it? Is there more than one object?
    12·1 answer
  • - A 47-year-old male presents to the emergency department complaining of malaise, fever,
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!