1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denpristay [2]
2 years ago
12

Please answer fast!! ​

Biology
1 answer:
Mariana [72]2 years ago
5 0

Answer:

bran and memory?

Explanation:

You might be interested in
What allows scientists to predict future climate change with some sense of accuracy?
IgorLugansk [536]
They can look at previous data and compare it to current data of the climate, from there they can estimate climate change. Example: in 1977on july 23rd the temperature was 28°C. on july 23rd 2017 the temperature was 32°C. the temperature in 40 years the temperature changed by 4°C
7 0
2 years ago
Read 2 more answers
What does the polysaccharide monomer look like
faltersainse [42]
Starch<span>, </span>is a polysaccharide<span> made up of hundreds of glucose molecules bonded together</span>
5 0
2 years ago
In the terrestrial food web above, what would be the effect of a farmer introducing a rat poison in to the ecosystem that is tox
love history [14]

Answer:

As explained below

Explanation:

  • The terrestrial food web is a food web that is characterized by all land animals and is largest terrestrial food chain on earth as the farmer tends to introduce a rat poison in this food web the rat may get killed by the medicine but if the same rate may be eaten by a snake the poison that killed the rat may infect the snake.
  • Hence the pollutant may climb up the ladder and intoxicate the hawk that depends on small animal for prey which may be further eaten by a man or other animal like a cat may then spread this disease or the infection to other upwards in the food chain and thus the process of Biomagnification takes place in the ecosystem.
8 0
3 years ago
 The tool that measures air pressure is called what?
sergiy2304 [10]

Answer: A barometer !

Explanation:

Hoped this helped ! :)

3 0
2 years ago
Give answers please
egoroff_w [7]

Part 1:

A solution that causes a cell to swell is a hypotonic solution.

In an isotonic solution, there is no change in the size of the cell.

All three cause osmosis.

A solution that causes a cell to shrink is a hypertonic solution.

Part 2:

1. H. Energy

2.D. Endocytosis

3.G. Diffusion

4.B. Exocytosis

5.E. Facilitated Diffusion

6.A. Osmosis

7.C. Active Transport

8.F. Passive Transport

Sorry. I don't know how to explain part 3 ,but I tried and failed so I deleted it. Part 1 and 2 are correct though.

3 0
3 years ago
Other questions:
  • Nucleic acids are one of the four major macromolecules. The main function of nucleic acids is to blank.
    11·1 answer
  • Help please will give brainliest!
    10·2 answers
  • A decrease in the oxygen-carrying ability of the blood, for any reason, is a condition known as ________.
    5·1 answer
  • Six-year-old Demetri and 4-year-old Lucien's mother gave each boy a glass of juice with their lunch, but Demetri asked her to sw
    13·1 answer
  • For science fair experiment you decide to test a certain type of plant to see how well it can grow when is kept out of sunlight
    5·1 answer
  • Can someone help me with this please
    10·1 answer
  • Birth defects can be caused by:
    7·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What structure is common to all six kingdoms of living organisms
    11·1 answer
  • There are several different models that represent compounds. One type of model is shown.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!