Stem cells have the ability to divide

1 answer:

7 0

Stem cells provide new cells for the body as it grows, and replace specialised cells that are damaged or lost. They have two unique properties that enable them to do this: They can divide over and over again to produce new cells. As they divide, they can change into the other types of cell that make up the body.

Hope it helps you in understanding!

Mark my answer brainliest!

Follow me!

Give me a heart if u like it!

You might be interested in

Please help, it's my last question

NikAS [45]

Answer:

As it gets closer to the sun.

Explanation:

Hope this helps and one of the mods doesn't take it down.

6 0

3 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved