1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artyom0805 [142]
3 years ago
9

Which animal adapts in goa​

Biology
1 answer:
kirza4 [7]3 years ago
7 0

Answer:

elephant

Explanation:

An important and widely found animal of Indian tropical rainforests is the elephant. It has adapted remarkably to the conditions of this region.

hope it helps

pls mark me as brainliest

You might be interested in
What do bacteria do inside your digestive tract?
SashulF [63]
Bacteria is good, but there is some bad. in this case, your talking about your digestive track therefore, this is good bacteria and what bacteria does is it breaks down the stuff that your body cannot break down by itself so the answer is C I hope this helped and I hope it was the branist answer
3 0
3 years ago
A cat gives birth to kittens that do not look identical to either parent but rather look like a combination of both. however, a
ELEN [110]
Codominance and dominance of alleles
7 0
2 years ago
Which taxonomic level has the closest relation? *<br> O Family<br> O Phylum<br> O Class<br> O Order
Dominik [7]
Class bc isnfnsfbwkdkcks
4 0
3 years ago
The Isotope carbon-14 has 6 protons and an atomic mass of 14. Carbon-14 has:
levacccp [35]
So there are 8 neutrons.
3 0
3 years ago
Which statement about a physical and chemical changes is true?
Verizon [17]
I think the best answer for this question would be B)
8 0
3 years ago
Read 2 more answers
Other questions:
  • How do seabirds get caught in fishing nets ?
    13·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Hellppp Marine Science. What is a scientific experiment?
    10·2 answers
  • Mistletoe is an evergreen shrub that can produce most of its own food. Often, mistletoe can be found living on trees and taking
    12·1 answer
  • Which answer correctly explains how the atp molecule differs in function from the adp molecule?
    9·2 answers
  • As more developing nations industrialize it can be expected that
    9·2 answers
  • Conocer la configuración electrónica de un átomo es importante porque Conocer la configuración electrónica de un átomo es import
    9·1 answer
  • List three contributing factors of an eating disorder Plzz help ASAP
    6·2 answers
  • Can you pls pls help me?
    8·2 answers
  • Internal forces of sources which what is exert on each other in the bodies are part of the system is 
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!