The whole idea of the woman wanting a room that is not so dark and creepy supports the idea of a gothic element. John doesnt want anything related to the outside.T<span>he woman here is trying to escape and feeling trapped and unable to control her own fate. </span>
Answer:
By applying Chargaff's rule, which states that A only bonds with T and C only bonds with G in a DNA strand. One other factor that makes the rule true is because of the presence of hydrogen. Hydrogen ensure the bonding between the bases which holds the DNA Strands together.
Explanation:
By Applying Complementary Base-Pairing Rules, Let's say you have a DNA sequence of a specific gene on one strand of DNA. You can then use complementary base pairing rules to figure out the other DNA strand that makes up the DNA molecule. For example, let's say you have the following sequence:
AAGGGGTGACTCTAGTTTAATATA
You know that A and T are complements of each other and C and G are complements of each other. That means the DNA strand that pairs with the one above is:
TTCCCCACTGAGATCAAATTATAT
Use the rule and example and fill in the table.
<span>a simply or hastily executed drawing or painting</span>