1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Georgia [21]
3 years ago
8

20 POINTS PLZ HELP PLZ

Biology
1 answer:
Natali [406]3 years ago
4 0

Answer:

Cnidarian

Explanation:

You might be interested in
Segments of DNA transferred from parent to offspring are called
egoroff_w [7]

Answer: genes

Explanation: trust

7 0
3 years ago
Read 2 more answers
Summarize the role of bacteria in keeping the nitrogen cycle balanced.
Anna11 [10]

Answer:

dear user

the answer is given above

7 0
3 years ago
An increase in which gas would cause the most greenhouse warming of earth’s atmosphere
Pani-rosa [81]

Answer:Carbon dioxide accounts for most of the nation's emissions and most of the increase since 1990. Transportation is the largest source of greenhouse gas emissions in the United States, followed by electricity generation.

Explanation:

4 0
2 years ago
Identify two life functions involved in meeting the<br> energy demands of a cell or an organism
Alexus [3.1K]

Answer:

<em>Respiration and photosynthesis. </em>

Explanation:

<em>Respiration provides the cell with oxygen while photosynthesis provides it with carbon dioxide. Both functions release what is needed for the other. Therefore, these functions interact.</em>

7 0
3 years ago
2. Which characteristic is true of sexual reproduction but not of asexual<br> reproduction?
Cerrena [4.2K]
I think it’s the last option
5 0
3 years ago
Read 2 more answers
Other questions:
  • Predictable amounts of rainfall in each of the 4 seasons is an example of a pattern.
    11·2 answers
  • Need help with biology homework!​
    11·1 answer
  • Can someone help me please?
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What do scientists think life developed from?
    10·2 answers
  • Which type of cell has a large, central vacuole that controls water pressure?
    11·2 answers
  • The majority of mechanical digestion occurs in the : select one:
    13·2 answers
  • State two proteins in blood which are responsible for determine the blood group of a person​
    5·1 answer
  • How are musk ox affected by a lengthened warm season?
    11·1 answer
  • Complete the following sentence.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!