1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Georgia [21]
2 years ago
8

20 POINTS PLZ HELP PLZ

Biology
1 answer:
Natali [406]2 years ago
4 0

Answer:

Cnidarian

Explanation:

You might be interested in
What do organisms use 90% of their energy/food for and what happens to the other 10%?
stira [4]

Explanation:

  • Ten Percent Rule: What happens to the other 90% of energy not stored in the consumer's body? Most of the energy that isn't stored is lost as heat or is used up by the body as it processes the organism that was eaten

4 0
3 years ago
What cell structure causes the shape of chloroplasts to be round?
morpeh [17]

Answer: A plant cell has a cell wall, a central vacuole, and phosphids or chloroplasts. The cell wall provides structural support and protection.

4 0
3 years ago
“Is the material too general, too technical, or just right for my need?” When would you ask this question?
Ierofanga [76]
I think the answer is <span>D) when evaluating a source for authority</span>
6 0
3 years ago
Read 2 more answers
Which of the following is likely to be most affected by weathering caused by wind?
hjlf
Where are the choices? Can you give the choices so we can answer the question?
4 0
3 years ago
Read 2 more answers
What is one way carbon is taken out
Rashid [163]

Answer:

C

Explanation:

Plants and Animals breathe in carbon and convert the carbon molecules into oxygen!

5 0
3 years ago
Read 2 more answers
Other questions:
  • Jupiter is 317 times more massive than the Earth. Its gravitational attraction is _____ Earth's.
    11·2 answers
  • Whats the difference between a neap tide and a spring tide
    13·2 answers
  • What has the growing human population done to the rest of life on Earth?
    12·2 answers
  • A lizard sitting on a rock would be considered the ______level of organization.
    5·1 answer
  • Which of the following organisms is the most harmful to the tree it grows on?
    7·2 answers
  • Choose the best description of the relationship between evolution and natural selection.
    13·2 answers
  • What do photosynthesis and cellular respiration have in common
    8·1 answer
  • The main organs of the excretory system are the __
    7·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which of the following statements best describes the process of photosynthesis?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!